Journal of Apicultural Research ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/tjar20 Standard methods for pollen research Maria G. Campos, Ofélia Anjos, Manuel Chica, Pascual Campoy, Janka Nozkova, Norma Almaraz-Abarca, Lidia M. R. C. Barreto, João Carlos Nordi, Leticia M. Estevinho, Ananias Pascoal, Vanessa Branco Paula, Altino Chopina, Luis G. Dias, Živoslav L. j. Tešić, Mirjana D. Mosić, Aleksandar Ž. Kostić, Mirjana B. Pešić, Dušanka M. Milojković-Opsenica, Wiebke Sickel, Markus J. Ankenbrand, Gudrun Grimmer, Ingolf Steffan-Dewenter, Alexander Keller, Frank Förster, Chrysoula H. Tananaki, Vasilios Liolios, Dimitrios Kanelis, Maria-Anna Rodopoulou, Andreas Thrasyvoulou, Luísa Paulo, Christina Kast, Matteo A. Lucchetti, Gaëtan Glauser, Olena Lokutova, Ligia Bicudo de Almeida-Muradian, Teresa Szczęsna & Norman L. Carreck To cite this article: Maria G. Campos, Ofélia Anjos, Manuel Chica, Pascual Campoy, Janka Nozkova, Norma Almaraz-Abarca, Lidia M. R. C. Barreto, João Carlos Nordi, Leticia M. Estevinho, Ananias Pascoal, Vanessa Branco Paula, Altino Chopina, Luis G. Dias, Živoslav L. j. Tešić, Mirjana D. Mosić, Aleksandar Ž. Kostić, Mirjana B. Pešić, Dušanka M. Milojković-Opsenica, Wiebke Sickel, Markus J. Ankenbrand, Gudrun Grimmer, Ingolf Steffan-Dewenter, Alexander Keller, Frank Förster, Chrysoula H. Tananaki, Vasilios Liolios, Dimitrios Kanelis, Maria-Anna Rodopoulou, Andreas Thrasyvoulou, Luísa Paulo, Christina Kast, Matteo A. Lucchetti, Gaëtan Glauser, Olena Lokutova, Ligia Bicudo de Almeida-Muradian, Teresa Szczęsna & Norman L. Carreck (2021) Standard methods for pollen research, Journal of Apicultural Research, 60:4, 1-109, DOI: 10.1080/00218839.2021.1948240 To link to this article: https://doi.org/10.1080/00218839.2021.1948240 Published online: 07 Sep 2021. Submit your article to this journal Article views: 799 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=tjar20 Citing articles: 1 View citing articles REVIEW ARTICLE Standard methods for pollen research Maria G. Camposa , Ofelia Anjosb,c , Manuel Chicad , Pascual Campoye , Janka Nozkovaf, Norma Almaraz-Abarcag , Lidia M. R. C. Barretoh, Jo~ao Carlos Nordii, Leticia M. Estevinhoi , Ananias Pascoali , Vanessa Branco Paulai, Altino Chopinai, Luis G. Diasi , Zivoslav L. j. Tesicj , Mirjana D. Mosicj, Aleksandar Z. Kostick , Mirjana B. Pesick , Dusanka M. Milojkovic-Opsenicaj , Wiebke Sickell , Markus J. Ankenbrandm , Gudrun Grimmern, Ingolf Steffan-Dewenterm , Alexander Kellero , Frank F€orsterp , Chrysoula H. Tananakiq , Vasilios Lioliosp , Dimitrios Kanelisq , Maria-Anna Rodopoulouq , Andreas Thrasyvoulouq , Luısa Pauloq, Christina Kasts , Matteo A. Lucchettis, Ga€etan Glausert, Olena Lokutovau, Ligia Bicudo de Almeida-Muradianv , Teresa SzczeRsnaw and Norman L. Carreckx,y aCoimbra Chemistry Centre (CQC, FCT Unit 313) (FCTUC) & Observatory of Drug-herb Interactions, University of Coimbra, Coimbra, Portugal; bIPCB– Instituto Politecnico de Castelo Branco, Castelo Branco, Portugal; cCEF, Instituto Superior de Agronomia, Universidade de Lisboa, Tapada da Ajuda, 1349-017, Lisboa, Portugal; dAndalusian Research Institute DaSCI “Data Science and Computational Intelligence”, University of Granada, Granada, Spain; eAutomatics and Robotics Center, Universidad Politecnica de Madrid, Madrid, Spain; fCentro Interdisciplinario de Investigacion para el Desarrollo Integral Regional unidad Durango, Instituto Politecnico, Nacional, Mexico; gInterdisciplinary Research Center for the Integral Regional Development-Durango, National Polytechnic Institute, Mexico City, Mexico; hApicultural Center of Research of Taubate University, UNITAU - Universidade de Taubate-SP, Taubate, Brazil; iCentro de Investigac¸~ao de Montanha (CIMO), Instituto Politecnico de Braganc¸a, Braganc¸a, Portugal; jFaculty of Chemistry, Department of Analytical Chemistry, University of Belgrade, Belgrade, Serbia; kFaculty of Agriculture, Department of Chemistry and Biochemistry, University of Belgrade, Belgrade, Serbia; lTh€unen Institute, Institute of Biodiversity, Braunschweig, Germany; mDZHI, Universit€atsklinikum W€urzburg, W€urzburg, Germany; nDepartment of Animal Ecology and Tropical Biology, Biocenter, University of W€urzburg, W€urzburg, Germany; oCenter for Computational and Theoretical Biology & Department of Bioinformatics, Biocenter, University of W€urzburg, W€urzburg, Germany; pBioinformatics & Systems Biology, Heinrich-Buff-Ring 58, Justus-Liebig-Universit€at, Gießen, Germany; qLaboratory of Apiculture-Sericulture, School of Agriculture, Aristotle University of Thessaloniki, Thessaloniki, Greece; rCATAA- Associac¸~ao Centro de Apoio Tecnologico Agro- Alimentar de Castelo Branco, Castelo Branco, Portugal; sAgroscope, Swiss Bee Research Centre, Bern, Switzerland; tNeucha^tel Platform of Analytical Chemistry, University of Neucha^tel, Neucha^tel, Switzerland; uThe National Institute of Horticultural Research Konstytucji 3 Maja 1/3, 96 - 100, Skierniewice, Poland; vPharmaceutical Science School, University of S~ao Paulo, S~ao Paulo, Brazil; wThe National Institute of Horticultural Research Konstytucji 3 Maja 1/3, 96 - 100, Skierniewice, Poland; xCarreck Consultancy Ltd. Woodside Cottage, Shipley, West Sussex, UK; yLaboratory of Apiculture and Social Insects, School of Life Sciences, University of Sussex, Brighton, East Sussex, UK (Received 20 March 2020; accepted 22 June 2021) “Bee pollen” is pollen collected from flowers by honey bees. It is used by the bees to nourish themselves, mainly by provid- ing royal jelly and brood food, but it is also used for human nutrition. For the latter purpose, it is collected at the hive entrance as pellets that the bees bring to the hive. Bee pollen has diverse bioactivities, and thus has been used as a health food, and even as medication in some countries. In this paper, we provide standard methods for carrying out research on bee pollen. First, we introduce a method for the production and storage of bee pollen which assures quality of the product. Routine methods are then provided for the identification of the pollen’s floral sources, and determination of the more important quality criteria such as water content and content of proteins, carbohydrates, fatty acids, vitamins, alkaloids, phen- olic and polyphenolic compounds. Finally, methods are described for the determination of some important bioactivities of bee pollen such as its antioxidant, anti-inflammatory, antimicrobial and antimutagenic properties. Metodos estandar Para la investigacion del polen El "polen de abeja" es el polen recogido de las flores por las abejas melıferas. El polen de abeja es utilizado para nutrir a las propias abejas, principalmente para proporcionar jalea real y alimento para las crıas, pero tambien se utiliza para la nutricion humana. Para este ultimo fin, se recoge en la entrada de la colmena en forma de granulos que las abejas llevan a la colmena. El polen de abeja tiene diversas bioactividades, por lo que se hautilizado como alimento para la salud, e incluso como medicamento en algunos paıses. En este artıculo, proporcionamos metodos estandar para llevar a cabo investigaciones sobre el polen de abeja. En primer lugar, presentamos un metodo de produccion y almacenamiento de polen de abeja que garantiza la calidad del producto. A continuacion, se ofrecen metodos de rutina para la identificacion de las fuentes florales del polen y la determinacion de los criterios de calidad mas importantes, como el contenido de Corresponding author. Email: mgcampos@ff.uc.pt and ofelia@ipcb.ptPlease refer to this paper as: Campos, M.G., Anjos, O., Chica, M., Campoy, P., Nozkova, J., Almaraz-Abarca, N., Barreto, L.M.R.C., Nordi, J.C., Estevinho, L.M., Pascoal, A., Paula, V.B., Chopina, A., Dias, L., Tesic, Z.L., Mosic, M.D., Kostic, A.Z., Pesic, M.B., Milojkovic-Opsenica, D.M., Sickel, W., Ankenbrand, M.J., Grimmer, G., Steffan-Dewenter, I., Keller, A., F€orster, F., Tananaki, C.H., Liolios, V., Kanelis, D., Rodopoulou, M.A., Thrasyvoulou, A., Paulo, L., Kast, C., Lucchetti, M.A., Glauser, G., Lokutova, O., Bicudo de Almeida-Muradian, L., SzczeR sna, T., Carreck, N.L. (2021) Standard methods for pollen research. In V. Dietemann, P. Neumann, N. L. Carreck, & J. D. Ellis (Eds.), The COLOSS BEEBOOK - Volume III: Standard methods for Apis mellifera hive product research. Journal of Apicultural Research, 60(4). https://doi.org/10.1080/00218839.2021.1948240  2021 International Bee Research Association Journal of Apicultural Research, 2021 Vol. 60, No. 4, 1–109, https://doi.org/10.1080/00218839.2021.1948240 agua y de proteınas, carbohidratos, acidos grasos, vitaminas, alcaloides y compuestos fenolicos y polifenolicos. Por ultimo, se describen metodos para la determinacion de algunas bioactividades importantes del polen de abeja, como sus propiedades antioxidantes, antiinflamatorias, antimicrobianas y antimutagenicas. 花粉研究的标准方法 “蜂花粉”是蜜蜂从花中采集的花粉。首先, 它用于蜜蜂本身的营养, 主要是提供蜂王浆和哺育 幼虫的食物, 其次也用于人类营养。对于后一目的, 花粉作为蜜蜂带到蜂巢的颗粒, 在蜂巢入口 处被收集。蜂花粉具有多种生物活性, 因此被用作健康食品, 甚至在一些国家被用作药物。本 文提供了研究蜂花粉的标准方法。首先, 我们介绍了一种生产和储存蜂花粉的方法, 以保证产 品的质量。然后提供常规鉴定方法来鉴定花粉源及更重要的质量标准, 如水含量和蛋白质、 碳水化合物、脂肪酸、维生素、生物碱、酚类和多酚类化合物的含量等。最后, 描述了测定 蜂花粉的一些重要生物活性的方法, 如其抗氧化、抗炎、抗菌和抗诱变特性。 Keywords: pollen; harvest; storage; multi-classification; computer; vision; corbicula; proteins; lipids; vitamins; antioxidant; minerals; toxicity; alkaloids; UHPLC-HRMS; phenolic; flavonoids; ABTS; FTIR-ATR; antioxidant; free radical scavenging activity; ORAC; DPPH; antimicrobial; antimutagenic; COLOSS; BEEBOOK Table of contents Page No. 1. Introduction 8 2. Producing bee pollen from harvest to storage 9 2.1. Production and handling of bee pollen before processing 10 2.1.1. Quality control in the apiary 10 2.1.1.1. Smoke 10 2.1.1.2. bee hives 11 2.1.1.3. Clothing 11 2.1.1.4. Tools 11 2.1.1.5. Inputs 11 2.1.1.6. Handling 11 2.1.2. Types of pollen traps 11 2.1.3. Chosen area of apiary production 12 2.1.4. Quality control in the collection 12 2.1.5. Quality control in the transport of raw material 12 2.2. Handling of bee pollen in the processing sector 12 2.2.1. Flowchart from production to processing of pollen 13 2.2.2. Processing bee pollen 13 Table of contents Page No. 2.3. Materials and equipment involved in the process 13 3. Inexpensive pollen load authenticationbymeansof computer vision and classification algorithms 14 3.1. General overview of the method 15 3.2. Description of the computational techniques 15 3.2.1. Segmentation algorithm 15 3.2.2. Homogenizing the pollen loads of the image by mean shift filtering 15 3.2.3. One-class multi-classification algorithm based on distance 17 3.2.4. Multi-classification confidence and ambiguity discovery process 18 3.3. Experimentation 18 3.3.1. Experimental setup: equipment and data 18 3.3.2. Image processing results 19 3.3.3. Numerical performance of the multi-classification algorithms 20 3.3.4. Validation of the complete prototype 20 3.4. Concluding remarks 21 4. Evaluation and classification of corbicular pollen morphology 21 4.1. Characteristics of corbicular pollen samples 22 4.2. Methodology for assessing the morphometric characters of corbicular pollen 22 2 M. G. Campos et al. Table of contents Page No. 4.2.1. Methodological procedures for evaluating the quantitative characteristics 23 4.2.2. Methodological procedures for evaluating the qualitative characteristics 24 4.2.3. List of descriptors and classification 24 4.2.3.1. General structure of descriptors list 24 4.2.3.2. Passports descriptors 25 4.2.3.3. General structure of characterization and evaluation descriptors 26 4.2.3.4. Methods and techniques for creating and modifying the descriptors 26 5. Identification of the floral origin by microscopy 28 5.1. Structure of the pollen grain 30 5.2. Floral origin 32 5.3. Features of pollen grains 32 5.3.1. Size 32 5.3.2. Shape 32 5.3.3. Apertures 34 5.3.4. Exine sculpture (exine ornamentation) and surface 34 5.3.5. Other features 35 5.3.6. Irregular grains 36 5.3.7. Pollen “types” 36 5.4. Colors of pollen 37 5.5. Methods of pollinic pollen analysis 37 5.5.1. Types of microscopy examination 37 5.5.1.1. Light microscope 37 5.5.1.2. Transmission electron microscope (TEM) 37 5.5.1.3. Scanning electron microscope (SEM) (three-dimensional image) 37 Table of contents Page No. 5.6. Microscopic techniques 38 5.6.1. Preparation of pollen grain slides from pollen loads for microscopic research 38 5.6.2. Identification of pollen under microscope 38 5.6.3. Description of pollen grains 38 5.7. Palinoindication of environmental pollution 38 5.8. Concluding remarks 38 6. Phenolic and polyphenolic profiles as fingerprints of floral origin of bee pollen 39 6.1. Materials and methods 40 6.1.1. Sample management 40 6.1.2. Sample collection 40 6.1.2.1. Pollen hand collected – reference samples 40 6.1.2.2. Bee pollen pellets/loads 40 6.1.3. Methods 40 6.1.3.1. HPLC/DAD analyses 40 6.1.3.1.1. Sample preparation (hand collected pollen and/or pollen from herbarium) 40 6.1.3.1.2. Sample preparation (bee pollen) 40 6.1.3.1.3. HPLC/DAD analysis 40 6.2. Theoretical rules for structural determination of the main phenolic acids and flavonoids 41 6.3. Quantification of the major floral specie (floral source) in a mixture 43 7. Determination of phenolic profile of bee pollen extracts by LC and LC/MS 44 7.1. Polyphenolics: importance, structure and classification 44 7.2. Preparation of pollen extracts for determination of phenolic compounds 44 7.2.1. Extraction of phenolic compounds from pollen – general procedure 47 7.2.2. Preparation of enzymatic hydrolysates from pollen 47 Standard methods for pollen research 3 Table of contents Page No. 7.2.2.1. Preparation of PEP 47 7.2.2.2. Preparation of EEPP 49 7.2.2.3. Preparation of feruloyl esterase hydrolysate from pollen’s exine 49 7.2.3. Application of SPE for pre-concentration of phenolic compounds for further LC and LC/MS determination 50 7.2.3.1. Application of SPE for pre-concentration of phenolic compounds from pollen 52 7.3. LC and LC/MS techniques 52 7.3.1. LC techniques 52 7.3.1.1. LC-DAD technique 52 7.3.1.2. LC-MS, MS/MS techniques 52 7.3.2. UHPLC-HESI-MS/MS technique for determination of phenolic compounds 53 8. Standard method for identification of bee pollen mixtures through meta-barcoding 54 8.1. Meta-barcoding protocol 54 8.1.1. Required materials 54 8.1.1.1. Reagents 54 8.1.1.2. Laboratory equipment 54 8.1.2. Pollen acquisition 54 8.1.3. Laboratory workflow 54 8.1.3.1. DNA extraction 54 8.1.3.2. Amplification 55 8.1.3.3. Normalisation 58 8.1.3.4. Quality control and quantification 58 8.1.3.5. Quantification 59 8.1.4. Sequencing 59 8.1.4.1. Sample library 59 8.1.4.2. PhiX control 59 Table of contents Page No. 8.1.4.3. Preparing reagent cassette and loading the sample 59 8.2. Bioinformatics 60 8.2.1. Required software 60 8.2.2. Classification 60 8.2.2.1. Reference databases 60 8.2.2.2. Preparation and classification of sequencing data 61 8.3. Data analysis 63 8.3.1. Required software 63 8.3.2. Prepare sample meta-data 63 8.3.3. Importing data 63 8.3.4. Recommended packages for further analysis 65 9. Standardmethod for the determination of protein content of pollen using the Kjeldahl method 65 9.1. Introduction 65 9.2. Determination of protein content by Kjeldahl method 65 9.3. Development of the method 65 9.3.1. Volume of NaOH solution 65 9.3.2. Volume of H3BO3 solution 66 9.3.3. Distillation time 66 9.4. Sample preparation 66 9.5. Validation of the method 66 9.6. Application of the method 66 10. Standard method for determination of lipid content of pollen using Soxhlet extraction 66 10.1. Introduction 66 10.2. Methodology for total lipid content determination 66 10.3. Development of the method 67 4 M. G. Campos et al. Table of contents Page No. 10.4. Validation of the method 67 10.5. Application of the method 67 11. Determination of sugar content in pollen using HPLC-RID 67 11.1. Introduction 67 11.2. Method for identification and quantification of sugars by HPLC-RID 70 11.2.1. Principle 70 11.2.2. Reagents 70 11.2.3. Equipment 70 11.2.4. Preparation of stock standard solution and working standard solutions of sugars 70 11.2.5. Sample preparation 70 11.2.6. HPLC-RID analysis 70 11.3. Validation of the method 71 11.4. Application of the method 71 12. Standard method for vitamin analysis in bee pollen 71 12.1. Introduction 71 12.2. B complex vitamins 71 12.2.1. Methods for B complex vitamins 71 12.2.1.1. Simultaneous extraction of vitamins B1, B2, vitamers from vitamin B6 and niacin 72 12.2.1.2. Chromatographic conditions for the analysis of the B complex vitamins in dried bee pollen 72 12.2.1.3. Determination of thiamin (vitamin B1), with pre-column reaction 72 12.2.1.4. Determination of riboflavin (vitamin B2) 72 12.2.1.5. Determination of vitamin PP through niacin and niacinamide vitamers 72 Table of contents Page No. 12.2.1.6. Determination of vitamin B6 through the vitamers pyridoxol, pyridoxal and pyridoxamine 72 12.3. Methods recommended to analyze antioxidant vitamins of bee pollen 72 12.3.1. Determination of vitamin C 72 12.3.2. Determination of vitamin E 72 12.3.3. Determination of b-carotene (provitamin A) 72 12.4. Concluding remarks 73 13. Standard methods for mineral and trace elements 73 13.1. Introduction 73 13.2. Material and methods 73 13.2.1. Sample preparation 73 13.2.2. Methods of analysis 74 13.2.2.1. Flame and electrothermal atomic absorption spectrometry 74 13.2.2.2. Inductively coupled plasma atomic emission spectroscopy (ICP-AES) methods 74 13.3. Concluding remarks 74 14. Standard methods for pyrrolizidine alkaloid profiling by UHPLC-HRMS 75 14.1. Introduction 75 14.2. Materials and methods 76 14.2.1. Equipment and chemicals 76 14.2.2. Collection of plant pollen from PA-containing plants 76 14.2.2.1. Pollen collection from E. vulgare 76 14.2.2.1.1. Collection with forceps 76 14.2.2.1.2. Collection with cyclohexane 76 Standard methods for pollen research 5 Table of contents Page No. 14.2.3. Pollen collection from E. cannabinum 76 14.3. Extraction of PAs from plant pollen 77 14.4. Profiling of PAs in plant pollen with UHPLC-HRMS 77 14.5. Data processing 78 14.6. Concluding remarks 79 15. Standard methods for total phenolic compounds, total flavonoids and antioxidative capacity bee pollen evaluation by FTIR-ATR spectroscopy 80 15.1. Introduction 80 15.2. Materials and methods 85 15.2.1. Sample characterization and preparation 85 15.2.2. Reference analytical methods 85 15.2.2.1. Total phenolic and flavonoids content analysis 85 15.2.2.2. Antioxidant activity analysis 85 15.2.3. FTIR-ATR collection and data processing 85 15.3. Concluding remarks 85 16. Standardmethods for determination of antioxidant bioactivity 86 16.1. Introduction 86 16.2. Methods 87 16.2.1. 2,2-diphenyl-1-picrylhydrazyl (- DPPH) free radical scavenging activity principle 87 16.2.1.1. Variations in the -DPPH assay for bee pollen 88 16.2.1.2. Material and methods for -DPPH assay 88 16.2.2. Antioxidant capacity using ORAC (oxygen radical absorbance capacity) assay principle 88 16.2.2.1. Material and methods for antioxidant activity (ORAC) assay 89 16.3. Concluding remarks 89 Table of contents Page No. 17. Standardmethods for anti- inflammatory activities in bee pollen 89 17.1. Introduction 89 17.2. Determination of standard methods 89 17.2.1. Anti-inflammatory activities of BP in vitro 89 17.2.1.1. BP extract preparation 89 17.2.1.1.1. Materials and reagents 89 17.2.1.1.2. Procedure 89 17.2.1.2. BP sample preparation 90 17.2.1.2.1. Materials and reagents 90 17.2.1.2.2. Procedure 90 17.2.2. Anti-inflammatory activities of BP in vivo 90 17.2.2.1. BP extract preparation 90 17.2.2.1.1. Materials and reagents 90 17.2.2.1.2. Procedure 90 17.2.3. Animals 90 17.3. Concluding remarks 90 18. Standardmethods for antimicrobial activities in bee pollen 91 18.1. Introduction 91 18.2. Materials and methods 91 18.2.1. BP sample collection 91 18.2.2. Extract preparation of BP for antimicrobial analysis 91 18.2.3. Antimicrobial analysis by agar disk diffusion 92 18.2.3.1. Preparation of inoculum suspension 92 6 M. G. Campos et al. Table of contents Page No. 18.2.4. Antimicrobial analysis by agar well diffusion 92 18.2.4.1. Preparation of inoculum suspension 92 18.2.5. Antimicrobial analysis by micro-dilution in microtiter plate (96 wells) 92 18.2.5.1. Preparation of inoculum suspension 92 18.2.5.2. Calculating the lethal concentrations 93 18.3. Concluding remarks 93 19. Determination of standard methods for anti-mutagenic activities in bee pollen 94 19.1. Introduction 94 19.2. Determination of standard methods for anti-mutagenic activities in BP 94 19.2.1. Preparation of BP extracts 94 19.2.2. Anti-mutagenic activities in vitro 94 Table of contents Page No. 19.2.2.1. Materials and reagents 94 19.2.2.2. Procedure 94 19.2.3. Anti-mutagenic activities of BP in vivo 95 19.2.3.1. Materials and reagents 95 19.2.3.2. Experimental animals 95 19.2.3.3. Preparation of BP extracts 95 19.3. Concluding remarks on anti-mutagenic effects of BP 95 Acknowledgements 95 Disclosure statement 96 References 96 Appendix: authors 108 Standard methods for pollen research 7 1. Introduction Pollen production on an industrial scale can be consid- ered as a recent development, so there is a need for an international directive for quality control. In this chap- ter, the authors propose optimized methodologies based on the major skills developed in the field which can be used in the near future to fill that gap. This sec- tion aims to aid the understanding of actual production and the development of sanitary standards in the light of food security, standardized beekeeping management actions, collection of the product in the bee hives, transportation, sanitary treatment, processing and stor- age by agribusiness, resulting in a product with flavor, very delightful aroma and texture of excellent quality for food or nutraceutical purposes. To achieve the above characteristics, we also discuss corbicular pollen itself in terms of weight, size, color, shape and surface texture and, unified systems (descriptors) for the evalu- ation of corbicula morphological parameters of mono- floral pollen. Pollen is considered by some researchers to be one of the naturally available resources that may be regarded as a perfect food, since it is rich in essential amino acids, trace elements, enzymes, B-complex and some C and E vitamins. The pollen grains present a huge variation of morphological characteristics, estab- lished by genetic heredity and do not vary depending on environmental events or changes. In this context, the pollinic analysis of bee pollen is the best method to determine the plants used by honey bees, making it pos- sible, among other inferences, to establish the plant taxa in the regions used for the pollen forage. The goal is to provide global information regarding the pollinic analysis of this matrix and the analytical procedures that are most frequently applied, from the more laborious and time consuming to the quicker and more advanced. Among the last, flavonoid / phenolic acid profiles using a gradient HPLC/DAD method is described. Given the specie-specific feature of those profiles obtained with dif- ferent taxa collected by bees, they represent an import- ant tool for quality control concerning the botanical origin of both monofloral and complex mixtures of bee pollen. The first step in the determination of phenolic compounds is their appropriate extraction. The com- plexity of the structure of pollen grains requires mul- tiple-stage extraction of polyphenols. Here there will be explained different procedures for the preparation of pollen extracts containing phenolic compounds and proposed a general procedure. Also presented are the applications of SPE for pre-concentration of the obtained phenolic fractions which facilitate further analysis. One of the sections describes LC and LC/MS techniques used for the identification and quantifica- tion of phenolic compounds with a detailed proced- ure for their determination by the UHPLC- HESI-MS/ MS technique. Another important question to be discussed is the fact that traditional pollen analysis via light microscopy has limitations in sample throughput as well as taxo- nomic resolution. Recently, pollen meta-barcoding methods have been developed as alternative approaches, where plant species identification of pollen grains works via DNA sequencing. However, these cur- rently utilize different genetic markers and sequencing platforms lessening study comparability. We here describe a detailed protocol of the latest development in this field as a standard method for pollen meta-bar- coding. It is highly cost-efficient, requires no palyno- logical knowledge, is performable in standard laboratories and profits from a well-established refer- ence database. For the main macro and micronutrients standard methods are proposed. Bee pollen has been consid- ered by some researchers as Mother Natures perfect food by containing nearly all nutrients required by humans as proteins, sugars, amino acids, lipids, vita- mins, minerals, nucleic acids, enzymes, phenolics and many more compounds. Pollen can also be character- ized as a supplementary food with varied enhancing effects in human health due to its nutritional proper- ties. Once pollen was exclusively a source of protein for bees’ diet, but recently, it has gained further atten- tion as a potential food source for human consump- tion too. The Kjeldahl method is widely used for protein determination. In this section, we examine the methodology concerning the volumes of the reagents, as well as the distillation time and the quantity of the sample, in order to elucidate the most suitable pro- cedure and a method been validated using bee pollen. There is increasing knowledge of the nutritional value of pollen as a supplementary food or medicine. One species of pollen is different from another, and not one has the same standard chemical composition, nor contains all the characteristics attributed to "pollen" in general. The lipid fraction is one of the main pollen constituents, and its determination is highly important. In this chapter, we describe a method for the deter- mination of lipid content of pollen investigated and optimized, by minimizing the reagent consumption and the sample quantity. Suggested methods to analyze micronutrients are also presented. Pollen vitamins as well as the literature found about them are included in the text. Methods for B-complex (B1, B2, B6 and PP, with vitamers) and anti- oxidant vitamins (vitamin E, C and carotenes as provita- min A) are explained and involve HPLC, open column and titrimetric determinations. The composition of min- erals in pollen collected by honey bees is dependent on the plant species visited. The variety of the samples col- lected is closely associated with the geographical apiary locality given by the floral sources (taxa) and the envir- onmental conditions in the area such as soil compos- ition, climatic conditions and agricultural crops grown 8 M. G. Campos et al. close to the apiary. Because plants can cause bioremedi- ation of some pollutants and are part of some other anthropogenic processes, they should also be consid- ered as an additional source of minerals in pollen (e.g., Cd, Cr, Cu, Fe, Ni, Pb and Zn). Monitoring these min- erals in this matrix, as well in other food products is very important as a quality parameter. Despite this, the publications in the field are scarce. Here we propose, from the research published on the mineral composition on pollen, different methodologies that can be car- ried out. Regarding toxic compounds, research has been lim- ited. However, as a starting point, attention has focused on pyrrolizidinic alkaloids (PA). Many plant species pro- duce pollen containing PAs that honey bees collect and bring as a protein source into the bee hive. Methods for identification of PA in pollen, together with the extraction and analysis of PAs, are essential tools for plant and food research. Mainly two approaches are commonly used: In the first approach, the total PAs (N- oxides and free-bases) are analyzed as the sum of the “necine bases” (the basic structures of PAs) by gas chromatography coupled with mass spectrometry (GC- MS). The second approach is based on liquid chroma- tography coupled with mass spectrometric detection (LC-MS). This method can detect both the free alkaloids and their N-oxides simultaneously, and has become the method of choice in recent years. Due to the lack of standards on the market and the multitude of PAs dis- covered so far, the detection, identification and quantifi- cation of PAs still represent a continuous challenge. In the following chapter, methods for the collection, extraction and profiling of PA plant pollen from Echium vulgare L. and Eupatorium cannabinum L. are presented. In the advanced methods that allow multiple analysis with a small amount of sample, it will be shown the potential of new integrated methods as the Fourier Transform Infrared (FTIR) spectroscopic method with Attenuated Total Reflectance (ATR) used, for example, to predict the total content of phenolic and poly- phenolic compounds. Determination of Free radical scavenging (EC50) and antioxidative capacity (ABTS) of bee pollen is also included. FTIR-ATR can be a useful technique for the quantification of total phenolic com- pounds, total flavonoids and antioxidant capacity of bee pollen that could improve the speed of laboratory anal- yses of this product. Concerning the bioactivity of pollen, several studies have been developed in order to elucidate the useful- ness of pollen, and therapeutic effects have been reported among others in the treatment of benign pros- tatitis and for oral desensitization of children who have an allergy, effects as anti-inflammatory, antimicrobial, anti-fungicidal, anti-mutagenic and immunomodulatory. Some studies reported that bee pollen accelerates mitotic rate, promotes tissue repair, enhances greater toxic elimination and reduces excessive cholesterol levels. Pollen has also been used to alleviate or cure conditions such as colds, flu, ulcers, premature aging, anemia, colitis and today is increasingly used as a health food supplement. For these reasons, bee pollen has attracted espe- cial attention by researchers throughout the world, and many scientific publications have been produced. In the last 17 years, at least 42 reports have been published about the antioxidant properties from dif- ferent taxa, evaluating these properties by various methods. The available information corresponds to bee pollen of 21 countries including Brazil, Mexico, New Zealand and Portugal, the countries where most attention has been dedicated to this topic. The reports cited in the current work give information about the antioxidant capabilities of bee pollen com- ing from around 75 well identified plant species belonging to approximately 52 families. The 2,2- diphenyl-1-picrilhydrazyl (DPPH) assay is the most popular method to evaluate the free radical scaveng- ing properties of bee pollen. It is based on the single electron transfer mechanism, is rapid, easy, accurate, reproducible, and presents good correlations with other assays like TEAC and b-carotene bleaching. The oxygen radical absorbance capacity (ORAC) assay is based on the hydrogen atom transfer mechanism, which reflects biological conditions, and has been pro- posed for evaluating antioxidant properties in foods. For all these reasons, DPPH and ORAC assays are proposed as standard methods to assess the antioxi- dant properties of bee pollen. The steps to carry out both assays are described. Due to related properties for human health, some information about standard methods commonly used for the determination of antimicrobial and antimutagenic activities in bee pollen are provided. In conclusion, a significant quantity of standard meth- ods for pollen research is now validated, and will be help- ful to be included in the future International Directive for Quality Control of bee pollen in the near future. 2. Producing bee pollen from harvest to storage To provide a good quality product it is necessary to get results in the conception of a professional, tech- nical and competitive apiculture, mainly dealing with the opening trade between the nations, MERCOSUR, European Union, and others (Barreto et al., 2006; Panetta, 1998). The beekeeping segment in the indus- try context, fits into the conception, “in search of excellence and quality,” concerning the significant role that the products represent to humanity (Bassi, 2000; Germano et al., 2000). Bee pollen harvesting requires special skills and guidelines. In this work we will represent the best methods for a better quality of product in line with the good practices in the field. Standard methods for pollen research 9 The main guidelines to obtain the best raw material are 1. Production plan – Such planning should aim at the highest yield in both quantity and quality. Inside an organization, technical support is crucial, and can be achieved by courses, training, internships and even from specialized consultancy, according to the needs of the production (Barreto et al., 2006); 2. Directing the raw material – It is of an unquestionable importance to direct the raw material for processing and acquisition in an ideal standard with the following sequence: production, harvest, transport, processing and storage.  Production: Standardized handling results in the har- vest schedule.  Harvest: Harvest is the first stage from raw material operations to processing; this process should undergo rigorous contamination control.  Transport: Incorrect transport can negatively affect the quality of raw material. The following parameters should be considered (Barreto et al., 2006): i. Adaptability of the vehicle to the type of raw material; ii. Suitable packaging for the quality and type of the collected material; iii. Necessity of traveling long distances (weather con- ditions, temperature, sun exposure, dust, rain- fall, etc.); iv. Internal environment of the transport (odor-free).  Processing: In this phase, the facilities should be planned according to the flowchart that is demonstrated, as well as the necessary equipment to process the prod- uct such as freezers, dehydrators, sieves, cold chambers and others (Barreto et al., 2006).  Storage: In this phase, consider the following requirements: a. Type of packing; b. Product identification, label; c. Temperature, humidity, luminosity; d. Time of travel to the facilities should be the lowest possible (Barreto et al., 2006).  During the next steps, other situations can occur, for example: Deterioration of raw material: It usually occurs by the action of living organisms (insects, micro- organisms, etc.), by physical processes (freezing, heat- ing, pressurizing, etc.) and biological (fermentation, rancidity, etc.). Follow all the previous recommenda- tions to avoid this situation, otherwise do not use the product (Franco, 2002; Silva, 2000).  Contamination of raw material: Avoid the following causes of contamination (Gilliam et al., 1989; Silva, 1999): a. Lack of cleanliness in rooms and personnel; b. Exposure of raw material to fresh air; c. Exposure of raw material to environment with dirt, garbage, animals with injuries and infectious illness and poor and badly kept premises. 2.1. Production and handling of bee pollen before processing Bee pollen is the result of specific conditions of the bee colonies, normally with regular population density of a bee hive in development, where the bees are stimulated to intensify pollen collection. Since it is a protein material production, this raw material will be susceptible to a more rigorous standard in the hygiene requirements, from the production up to its processing and storage (Barreto et al., 2006). 2.1.1. Quality control in the apiary The quality control of bee products begins in the api- ary because these products do not get their quality by handling, but by nature’s attribute. The regulation of good practices in the elaboration and food produc- tion is a broad subject that is applicable in most of the production. It is known that the microflora in the bee pollen can have two different origins: (1) by the normal microflora, originated from pollen, being yeast, mold and bacteria; (2) by outside microflora, originated from practices of handling, elaboration and product storage. To achieve a better-quality product some steps should be done follow this check list: a. Systematized handling of bee colonies; b. Feeding the bees with high quality and reliable prod- ucts when forage is scarce; c. Daily collection of bee pollen; d. Disposal of bee pollen collected on rainy days; e. Sanitation of equipment in contact with the pollen at the harvest period (pollen press, hive tool and brush); f. Sanitized bee gloves and beekeeper’s clothing; g. Packing of harvest and transport previously sanitized and dried; h. Enough harvest time and transport to keep the integ- rity level of the product until the processing facility. 2.1.1.1. Smoke. Smoke is a safety procedure used during the handling of bee colonies. However, the fuel materials, sawdust, should be sieved to avoid producing unwanted dust that can affect bee pollen pellets. The smoke should have a pleasant odor, and pine, cypress and eucalyptus leaves and lemongrass can be used as additives to the mixture. Animal manure must not be used. The smoke should not be aimed at the combs with honey (avoiding that the product acquires unpleasant flavor) or brood. The 10 M. G. Campos et al. smoke should be applied horizontally in the bee hive when there is no exposed frame. It should never be aimed directly at the raw material in production (Barreto et al., 2006). 2.1.1.2. bee hives. Nowadays bee hives are often already impermeable, which avoids the previous practice of painting then, with the risk of heavy metal contami- nated paints (Barreto et al., 2006) 2.1.1.3. Clothing. The overalls or coats used in the api- ary should be cleaned after each handling session to avoid contamination in the bee hive by moth eggs and microorganisms that may adhere to clothes (Barreto et al., 2006). 2.1.1.4. Tools. Hive tool, clean rubber gloves. After each handling, in case any bee hive is found conta- minated, these utensils should be substituted so as not to contaminate the next hive (Barreto et al., 2006). 2.1.1.5. Inputs. The main input used in the bee hive is the bees wax. The beekeeper should acquire this material in stores or suitable processing centers. Whenever buying bees wax, make sure it is packed with PVC film, whether there is moth or not (crumbled aspect in the plastic foil). Any wax that is directly packed with newspaper should be avoided as printing ink is a powerful source of heavy metals (Barreto et al., 2006). 2.1.1.6. Handling. The choice of technology to be used in production handling is crucial. The material applied in the production has to be standardized, and it needs to be easily handled to avoid higher bee losses, as well as allow perfect sanitation of the prod- uct. For example, some hive boxes made of wood are now being replaced by nontoxic plastic boxes that permit efficient sanitation. Another point is the handling standard; it refers to the conduction of the production in a way that the harvest can be realized in all bee hives in a timely fashion (Petersen et al., 2011). 2.1.2. Types of pollen traps Among frontal, floor, intermediate or bottom pollen traps (Figure 1), each one has its advantages and dis- advantages. The ideal pollen trap is one that can receive the pollen in a safe and hygienic manner. The frontal pollen trap is practical and hygienic but because it is attached to the main floor, it receives a significant amount of dirt resulting from the internal bee hive cleaning. The bees continuously remove particles from inside to outside of the hive, making the pollen trap dirty. In the intermediate internal pollen trap, it is opened a secondary drawer, the main one being closed with a ventilation screen. It is noticed that the dirt level decreases and even the pollen has a lower humidity level than the previously mentioned. However, it can cause an increase in the bees’ defensibility due to the obstruction of the main entrance. It is recommended to choose a pollen trap that can be easily placed and removed. In addition, a pollen trap that makes the handling easier, allowing better ventilation and sanitation, allowing the flight of drones and pro- tected against weather changes. In tropical countries such as Brazil, beekeepers have been using the “Tropical Africanized Type” (Figure 1) with good results (Barreto, 2004). The collection of pollen (Figure 2) should be done daily, there are some devices that prescribe the weekly collection of the product, but there is no consensus among scientists about such procedure. Figure 1. A tropical Africanized pollen trap (TTA). Figure 2. Pollen collection by beekeepers. Standard methods for pollen research 11 2.1.3. Chosen area of apiary production Choice of apiary location can be problematic. Today, the choice should be careful, taking into account the use of agrochemicals, both in crops and in animals. Pollution is not exclusive to urban areas, and unfortunately some rural areas can show con- tamination in air, water and or soil. Rubbish in the apiary attracts undesirable insects, exposing the raw material to the risk of unwanted contamination (Figures 3 and 4). 2.1.4. Quality control in the collection Damp compressed pollen should be collected separately from the raw materials intended for processing, and should only be used for bee feed (Figure 5). The collecting box should not be exposed to contamination from the ground. 2.1.5. Quality control in the transport of raw material At harvest, the beekeeper should be aware of the type of packaging used to transport the product from the apiary to the processing sector, thus avoiding: a. crushing of raw material; b. contamination with dust; c. transfer of odors and humidity as well as high temper- atures, which may interfere with the quality of the product to be processed. 2.2. Handling of bee pollen in the processing sector This sector should be provided with a reception room for production (raw material) and processing rooms, according to the Technical Regulation on Hygiene and Sanitary Conditions and Good Preparation Practices for Developers of Establishments/Industrialized Food (Example for Brazil – Ordinance 368 of 4 September 1997 (Brasil, 1997) obtained in www.agricultura.gov.br/ ada/dipoa/). Other countries have similar regulations. In these areas, verify the rules: a. machinery that will be in contact with the raw mater- ial should be in stainless steel (AISI 304); b. manipulation, the process of cleaning and sanitizing should be adopted integrally; c. use of heat, dehumidifiers, chemical agents, must have precise control; d. water used for cleaning the room and machinery should be of known origin with recognized purity. Figure 3. Conditions to be avoided in the apiary and surround- ing area. Figure 4. Bad conditions of the hives and packaging containers; hives on the ground are subject to rot and termite attack. Figure 5. Damp compressed pollen. 12 M. G. Campos et al. 2.2.1. Flowchart from production to processing of pollen 2.2.2. Processing bee pollen In the processing area, the handler must necessarily fol- low the sequence below (Barreto et al., 2006): a. Reception of raw material ("In Natura" pollen); b. Primary labeling, date and place of harvest; c. Removal of coarse dirt, dead bees, chalk brood mummies; d. Screening; e. Freezing to 18 C for 48 hours minimum and max- imum 15 days; f. Dehydration step I at a maximum temperature of 42 C for 8 hours; g. Cleaning by ventilation; h. Manual cleaning; i. Dehydration step II maximum temperature of 42 C for 4 hours; j. Checking moisture content of dehydrated bee pollen; k. Final filling of the dehydrated product; l. Final product labeling valid up to 12 months; m. Storage; n. Shipping. 2.3. Materials and equipment involved in the process The collection tray often used is a model made of non- toxic, broad and shallow plastic, suitable for food. Fresh pollen contains high humidity content (20 to 30%), conse- quently, fragile to large overlap, becoming brittle and caus- ing an increase of pollen powder, representing the most significant loss at the time of processing. These trays must be provided with a cover which will prevent dirt from becoming incorporated into the product during transport (Almeida-Muradian et al., 2012; Brasil, 1997, 2001). In Figures 6 and 7 can be seen the steps involved from the reception to the delivery of bee pollen. When the product arrives at the facilities, it has to be: a. Transferred to lots; b. Pass through wet sieving (usually with maximum cap- acity of 5 kg); c. Freeze. Pollen should be in a sterile polyethylene con- tainer and immediately placed in a freezer. Bee pollen will remain there for a minimum of 48hours to destroy Standard methods for pollen research 13 possible mites, eggs or larvae of the wax moth (Galleria spp.), and other insects. The freezing will also have the property of stabilizing and controlling the development of microorganism related to normal microflora con- tained in pollen (Ibrahim & Spivak, 2006). The collected pollen can be stored in the freezer for a period of a few weeks. After a month, it begins to show change in taste, texture and color; d. Dehydrated. For this step is necessary to have a green- house with adjustable thermostat, keeping the tempera- ture between 40 and 42 C. Internally, the equipment consists of stainless steel with shelves that receive trays with screens in stainless steel AISI 304 that will allow effi- cient cleaning and sanitizing. The dehydrating aims at the water removal until it reaches the maximum humidity of 4–8% (Campos et al., 2008), but for tropical countries 4% is often recommended (Thakur & Nanda, 2020). Frozen pollen is usually placed in a greenhouse, which facilitates its uniform distribution in the screened trays, but it should not be submitted to an immediate tempera- ture of 42 C. It is essential to respect a thawing period of the material to prevent damaging the product due to ther- mal shocks. It is suggested that after removing the pollen from the freezer, it should be transferred to a refrigerator for approximately 2 hours for defrosting. The distribution of pollen in the tray should be done in thin layers. Every instrument in contact with the pollen must be stainless steel to prevent contamination. The pollen must remain in the greenhouse from 8 to 12 hours. After dehydration, the packing of bee pollen will involve three steps: a. Transferring dehydration, sealed loads; b. Cleaning – First undergo the pollen in sieve particle size to have the larger lumps undone and separate the commercial pollen powder after applying dry air to remove dirt such as bee fragments that are possibly present. The final phase of cleaning is grooming mate- rials not previously removed, for example, any prop- olis that is still mixed with bee pollen; c. Packing – Should be done after cleaning, reducing the rehy- dration possibilities of the processed material. For this pro- cedure, you must use a nontoxic plastic bag, suitable for food packaging as primary, which remains protected by sec- ondary packaging of nontoxic plastic barrels of first use or food cardboard. Before closing it, air must be removed from the bag with help of a vacuum pump. Storage should be in dry conditions, with mild temperature and away from light. For fractional packing of bee pollen, it is suggested placing silica gel pads for foods – that will keep humidity level of the product stable (Brasil, 1997). 3. Inexpensive pollen load authentication bymeans of computer vision and classification algorithms Bee-keepers, bee-keeping associations, and laboratories are interested in detecting fraud in pollen, and require tools to standardize and authenticate bee pollen origin to guarantee their nutritive and health benefits. Microscopic analysis of pollen grains, which form bee pollen loads, is a precise method for identifying pollen origin. However, this process requires the laboratory work of melissopalynology experts, and is thus time consuming and costly. There have been many attempts to automate pollen grain identification by computer algorithms but there is no inexpensive, complete, and automated process (Allen, 2006; Boucher et al., 2002; Rodrıguez-Damian et al., 2006). Image processing techni- ques and one-class classification algorithms can be used to identify unknown pollen types. Concretely, the mean shift algorithm (Comaniciu & Meer, 2002) filters the pollen image and is used to homogenize pollen load color infor- mation. Then, one-class classification algorithms (Chandola et al., 2009; Moya et al., 1993) identify each local pollen type. The method makes use of a multi-classifier algorithm, designed to aggregate one-class classifier outputs, given a unique response with a confidence measure. Finally, an ambiguity discovery algorithm is also included to detect identical pollen type and reduce misclassification. The chapter provides general details of the algo- rithms involved in the methodology, describes the necessary hardware for the standard method, and presents the results of applying the image processing algorithms and one-class classifiers. In addition, the chapter presents the overall process to create a soft- ware dictionary with known local pollen types, how to use the graphical user interface, and a guide to separate and analyze the pollen loads of the images by type. The validation of the proposed standard methodology is car- ried out for the authentication of four pollen types, Cistus ladanifer, Rubus, Echium, and Quercus ilex, which serve as an example of the methodology (Otero & Losada, 2002). Totally, a dataset of around 2000 instan- ces has been used to validate the trained system. Figure 6. Processing “fresh” bee pollen; first screening. 14 M. G. Campos et al. 3.1. General overview of the method Figure 8 shows the outline of the method. In a nutshell, it starts with preparation of a pollen load sample to acquire the image by the computer vision system. Second, the pollen loads of the image are segmented from background (see Section 3.2.1) and filtered (see Section 3.2.2). Third, the color instances of the processed pollen loads are used to train a multi-classifier model based on one-class classifiers (one for each local pollen type). Finally, the multi-classifier outputs the authentication of each color instance, classifying them as a known local or non-local (outlier) pollen type. Section 3.2.3 provides more details about the classification algorithms. 3.2. Description of the computational techniques 3.2.1. Segmentation algorithm The Otsu segmentation algorithm (Otsu, 1979) is the one applied to the gray-scale image to extract the pollen loads from the background. Later, a morphological opening oper- ation is applied to the thresholded binary image (Gonzalez & Woods, 2008). The goal of this computer vision oper- ation is to remove those small objects having less than 50 connected pixels in an 8-connected neighborhood. Those pixels extracted in the latter phase are analyzed by the remaining processing algorithms. Their color information can be represented in several ways. The most common is the RGB space where colors are represented by their red, green, and blue components in an orthogonal Cartesian space. However, the RGB space does not represent the higher levels processes which allow human color perception. Color is bet- ter represented in terms of hue, saturation, and intensity, as HSI or HSV spaces do (Lucchese & Mitra, 2001). However, the latter color spaces are not perceptually uniform. The CIE and Luv and Lab are ideal for color recognition because of the following three properties: a) separation of achromatic information from chromatic information, b) uni- form color space, and c) similarity to human visual perception. In these color spaces, for instance, the Euclidean distance between two color points can be easily calculated. This prop- erty will ease the work of the classification algorithms. 3.2.2. Homogenizing the pollen loads of the image by mean shift filtering Each extracted pollen load from the image has many dif- ferent Luv color values, possibly as many as pixels contained in the load. This has a negative impact on pol- len load color authentication since human experts iden- tify each pollen load as a unique color. Therefore, we Figure 7. Example of a warehouse for bee pollen production in Brazil. This is one of the largest in Latin America, located in the state of Bahia, northeast Brazil. The main source of pollen is the coconut palm, achieving high standards of excellence and quality of the product: (a) Dehydration room 40 C; (b) distribution trays; (c) aeration of the dehydrated product room. Standard methods for pollen research 15 need a procedure of homogenizing the images of pollen loads, which is divided into three different steps: 1. First, we apply an image processing algorithm before using the classification methods. The goal is to homogenize and smooth the large quantity of different color points of a pol- len load in just a few unique and representative color instances. One of the best methods for discontinuity-pre- serving smoothening in image processing is the mean shift algorithm, proposed in Comaniciu and Meer (2002), and in line with the feature space analysis. The main strengths of the mean shift algorithm are: (a) it is an application inde- pendent tool, (b) it is suitable for real data analysis, (c) it does not assume any prior shape on data clusters, (d) it can handle arbitrary feature spaces and (e) it has only one par- ameter, the bandwidth selection window size. The mean shift procedure, originally presented by Fukunaga and Hostetler (1975), is a procedure for locating the maxima of a density function given discrete data sampled from that function. It is also an iterative method, starting with an initial estimate or points xi and a G kernel function. This kernel function determines the weight of nearby points for the re- estimation of the mean. Denote by yj with j ¼ 1, 2, ::: the sequence of successive locations of the kernel G : yjþ1 ¼ Pn i¼1xiG k xxih k  2 Pn i¼1G k xxih k  2 , (1) is the weighted mean at yj computed with the kernel G and y1 is the center of the initial position of the kernel. Taking this theory as a base, Comaniciu and Meer (2002) extended the mean shift procedure for filtering and segmenting images. A color image is typically represented as a two-dimensional lattice of 3-dimen- sional vectors (pixels). The space of the lattice is known as the spatial domain, while the color is the range domain. For both, the mean shift algorithm will work with the Euclidean metric defined in the previ- ous section for the color space. 2. When both domains are concatenated, the dimensions of the joint spatial range domain are compensated by a proper normalization. Thus, the multivariate kernel is defined as the product of two radially symmetric kernels, and the Euclidean metric allows a single band- width parameter for each domain: Khs , hr xð Þ ¼ C h2s h p r k k x s hs k2   k k x r hr k2   , (2) where xs is the spatial part, xr is the range part of a feature vector, kðxÞ the common profile used in both domains, hs and hr the kernel bandwidths, and C the normalization constant. A kernel process usually pro- vides satisfactory results and then the user just has to provide one parameter h ¼ ðhs, hrÞ which controls the size of the kernel, and thus the smoothening reso- lution. Nevertheless, replacing the pixel in the center of the window by the average of the pixels in the win- dow blurs the image. Discontinuity-preserving smoothening techniques, on the other hand, reduce the amount of smoothening near abrupt changes. The mean shift algorithm uses a bilateral filtering which works in the joint spatial-range domain. The data are independently weighted in the two domains and the Figure 8. The proposed standard method for detecting unknown pollen loads. The processing chain finishes with an authentica- tion output. 16 M. G. Campos et al. centered pixel is computed as the weighted average of the window. The kernel in the mean shift procedure moves toward the maximum increase in joint density gra- dient, while bilateral filtering uses a fixed static window. 3. The last step is the application of the mean shift filter- ing algorithm. The algorithm works as follows. Let xi and zi, with i ¼ 1, 2, :::, n be the (pþ 2)-dimensional input and filtered image pixels in the joint spatial- range domain. Being the superscripts s and r the spa- tial and range components of a vector, respectively, and c the point of convergence, for each pixel: a. Initialize j ¼ 1 and yi, 1 ¼ xi; b. Compute yi, jþ1 according to Equation (2.1) until convergence, y¼ yi, c; c. Assign zi ¼ xsi , yri, c   : The spatial bandwidth has a distinct effect on the out- put when compared to the range (color) bandwidth. Only features with large spatial support are represented in the filtered image when hs increases. On the other hand, only features with high color contrast remain when hs is large. 3.2.3. One-class multi-classification algorithm based on distance In Chica and Campoy (2012) authors compared four differ- ent one-class classification approaches for the problem: Gaussian, Parzen classifier, SVDD and kNN: The kNN algo- rithm with k ¼ 1 showed the best performance. Then, this is the proposed algorithm for the pollen recognition system. kNN, originally provided by Dasarathy (1991), is a dis- tance-based one-class classifier based on the assumption that normal data instances occur in dense neighborhoods while anomalies occur far from their closest neighbors. The basics of the algorithm for one-class classification is that the anomaly Figure 9. The computer vision system needs inexpensive hard- ware such as a camera and a stand to control illumination. Figure 10. Different images of pollen load samples which were taken with our vision system. Left and central images belong to known pollen types (Rubus, Cistus ladanifer, Quercus ilex, and Echium, respectively). Right images are non-local samples and must be rejected by the system. Standard methods for pollen research 17 score of a data instance is defined as the distance with its kth nearest neighbor in each dataset. Nearest neighbor classifiers always require the defin- ition of distance or similarity measures between two data instances. For continuous features, the Euclidean distance is the most popular choice. In the case of choosing k ¼ 1 as the parameter of the algorithm, each new instance z will be considered as target or outlier depending on the classi- fication of its closest neighbor in the training data. In multi-class anomaly detection (our pollen authentication problem) training data contains labeled instances belonging to multiple normal classes but it does not contain anomalous instances. A test instance is considered anomalous if it is not classified as normal by any of the classifiers. To do this, a confi- dence score obtained from the prediction output of the clas- sifier is normally provided. If none of the kNN classifiers are confident in classifying the test instance, the instance is then labeled as anomalous (Chandola et al., 2009). We have followed the latter approach, modeled as follows: jCj being a set of known local bee pollen load types, the training data will contain instances belonging to jCj classes. In order to use one-class kNN classifiers and be able to reject unknown pollen load types, we have to decompose the classification system in jCj binary sub-problems. Thus, we will train jCj different kNN clas- sifiers: f1, f2, :::fjCj: An ensemble scheme is used to fuze all of them in a multi-class authentication output. Therefore, for each pollen color instance x we first map each one-class classifier output fiðxÞ to a posterior probability Pðy ¼ cjxÞ: These probabilities are also nor- malized in the range ½0, 1: The posterior probability of each classifier’s target can be considered as the confi- dence CFocðy ¼ cjxÞ for one instance x to belong to class c: In order to classify an incoming pollen load sample as one of the jCj possible pollen types we build a multi-clas- sifier. The multi-classifier will compare the confidence CFocðyjxÞ of all the one-class classifiers and will provide a global prediction from the most reliable one-class classi- fier. The multi-classifier prediction x is given by: x ¼ max 1c Cj j CFoc cjxð Þ: (3) 3.2.4. Multi-classification confidence and ambiguity discov- ery process It is also necessary to estimate the confidence of the multi-classifier prediction. To do this we first introduce two parameters, Toc and Tm, as done in Goh et al. (2005) in Equations (4) and (5): Toc ¼ CFoc xxð Þ; (4) Tm ¼ Toc  max 1cjCj, c 6¼x CFocðcjxÞ: (5) Toc is the highest confidence factor from the jCj binary one-class classifiers and determines the multi-classifier prediction class x: However, Toc might not be enough to estimate the global confidence of the multi-classifier prediction. This is the reason for introducing the second parameter, the multi-class margin Tm: Wrong predictions could have high Toc but small Tm: Then, correct predic- tions must have high multi-class margin values Tm: Goh et al. (2001) showed that there is a better separ- ation of correct from erroneous predictions if the multi- class margin variable is used. After a preliminary experimen- tation, we set parameters Toc and Tm to 0.5 and 0.01, respectively, to be used in the final decision stage of the multi-classifier, as shown in the rule of Equation (6). x is accepted, if Toc  0:5 and Tm  0:001, outlier, otherwise:  (6) Sometimes, one or more bee pollen types could have exactly the same color description as another. In that case, the kNN multi-classification system must be able to detect, during the training phase, that one incoming local pollen type is identical to one already existing (i.e., it is already included in the dictionary). The goal for the soft- ware prototype is to also warm the user not to intro- duce duplicated entries in the dictionary. This mechanism is called ambiguity discovery. Being em1 a sensitivity-speci- ficity error of a multi-classifier before the inclusion of the new pollen type, and em2 the error of a multi-classi- fier after the inclusion of the classifier of the new pollen type, we define De ¼ ðem2  em1Þ as the difference between them. In our case we have used the F-measure (van Rijsbergen, 1979) as the em1 error measure. The ambiguity discovery process is launched every time the De parameter is higher than a fixed value. Then, if De exceeds a threshold value, ambiguity discov- ery is triggered, and the process works as follows: 1. The confusion matrix of the new multi-classifier for the testing data is computed; 2. The maximum value of ðKi, LjÞ is calculated with i 6¼ j, K being the vector of real classes and L the vector of predicted classes; 3. The user is asked about merging conflicting classes ci and cj into a unique class ci; 4. The multi-classifier is trained according to the response of the user in the third step. 3.3. Experimentation Section 3.3.1 explains the data used for the experimen- tation. Section 3.3.2 explains the image processing and filtering results. Section 3.3.3 presents the results to analyze the behavior of the one-class classifiers and multi-classification systems. Finally, Section 3.3.4 shows the validation of both the software prototype and pro- posed standardization process. 3.3.1. Experimental setup: equipment and data The main equipment used in the experiments is com- posed of: 18 M. G. Campos et al.  Camera and optics device to obtain images of the pol- len load samples. The resolution does not need to be extremely high since only color and edge information will be processed. (Example: color camera uEye UI- 1485LE-C (www.ids-imaging.com) with an Aptina CMOS sensor in 5 M Pixels resolution (2560 1920 pixels). The light-weight housing of the UI-1485LE fea- tures a C/CS lens mount with adjustable flange back distance. A focal lens obtained from Goyo Optical (www.goyooptical.com) is also used.  The lighting conditions are decisive and must be con- trolled. An external lighting generator, which points out the pollen load sample is employed to ensure that the color of the pollen loads do not change for the different runs. The external lighting consists of a 50 LED-based ring light from CCS Direct Lighting (www.ccsgrp.com). This lighting device can be mounted on a CS mount.  A support device is needed to allow a fixed position for the camera, lens, and lighting. The sample of pollen loads is placed on the base of this supporting device in order to get a stable and low-cost system to acquire images of the sample for a posterior processing and analysis (see Figure 9).  Finally, a computer must be connected to the camera via USB to install the software. Proprietary software can be used to take snapshots of the pollen load sam- ples. Then, the proposed computer vision and classifica- tion system will be controlled by the software prototype to ease the labor of the expert. Different samples from Spanish bee pollen loads were obtained from beekeepers to build the authentication models and validate them against nonlocal samples. Samples belong- ing to four Spanish local pollen types (Rubus, Echium, Cistus ladanifer and Quercus ilex) and non-local samples were identi- fied, labeled, and grouped by experts. Figure 10 shows these pollen loads samples. In this figure we can see how, even for experts, the separation and classification of the pollen loads by color is difficult and subjective. One can also see in the fig- ure how non-local samples can be misleading (bottom right loads of Figure 10). 3.3.2. Image processing results The first step of the method is processing the images of the pollen samples (taken in TIFF format and resolution of 1024 768 pixels). The software will apply the filter- ing algorithm after segmenting pollen loads from back- ground. As explained in Section 3.2.2, the selection of an appropriate bandwidth parameter for the mean shift algorithm is not trivial. This selection depends on the type of images. The implemented mean shift algorithm receives the spatial bandwidth hs, the range bandwidth hs, and the minimum segment area in number of pixels. The last parameter is fixed to a high value (20 pixels) not to segment a pollen load into different parts. The selection of the other two parameters is more difficult. High spatial bandwidth values merge different bee pollen loads because they are normally close to each other. Low range bandwidths do not effectively aggregate the entire color information of the pollen loads. We conducted a preliminary experiment with dif- ferent values. In order to illustrate the importance of this parameter selection, we show in Figure 11 an ori- ginal Rubus data sample together with three output images after applying the filtering algorithm with differ- ent values of hs : 7, 15, and 30. Additionally, it is important to remark that higher bandwidth values mean higher computational time. Thus, we set the bandwidth values to h ¼ hs, hrð Þ ¼ ð15, 20Þ for the experimenta- tion, which seems one of the best parameter combin- ation for this pollen load authentication problem. We generate, from the processed and filtered images, a set of 3146 color instances. Each color instance has three input features, corresponding to the Luv color space values, and its class (one of the four pollen types or an outlier class). From this set of color instances, 400 of them are used for training the four one-class classifiers (100 for each pollen type), 800 to test the one-class classifiers (400 belonging to the four know pollen types and 400 were outliers). The rest of the 1946 instances are used to validate the multi-classifi- cation system (Section 3.3.4). Table 1 summarizes these groups of experimental data. Table 3. Evaluation measures of the final multi-classifier. kNN multi-classifier model Accuracy (%) FN rate FP rate 0% rejected during training 92.5488 0.0108 0.1161 10% rejected during training 94.6043 0.0935 0.0167 Two cases are listed; considering 0%, and considering 10% of data as outliers when training the one-class classifiers. FN and FP rates are calculated taking all the known pollen types as the positive class and the outliers as the negative. Table 2. Evaluation measures obtained by the one-class kNN classifiers for each of the four pollen types. Rubus Echium FN rate FP rate F-measure FN rate FP rate F-measure 0.05 0 0.9744 0.09 0 0.9529 Cistus ladanifer Quercus Ilex FN rate FP rate F-measure FN rate FP-rate F-measure 0.06 0 0.9691 0.01 0.0028 0.9851 Lower values mean better performance. Table 1. Description of the three independent datasets used to train, test the classifiers, and validate the one-class multi-classifier. Dataset name Total size Pollen types instances Outlier instances Training 400 400 0 Test 800 400 400 Validation 1946 1016 930 Standard methods for pollen research 19 3.3.3. Numerical performance of the multi-classification algorithms In this section we employ the classification accuracy, false negative and positive rates, F-measure, and confusion matrix to numerically validate the multi-classifier per- formance. A false negative (FN) occurs when the out- come of the classifier is incorrectly predicting as outlier when it is actually a target. A false positive (FP), on the other hand, occurs when the outcome is incorrectly pre- dicting as target when it is actually an outlier. The FN rate measures the number of FNs out of the total num- ber of negatives or outliers, and the FP rate calculates the fraction of FPs divide by the total number of posi- tives or target instances (Witten & Frank, 2005). The F- measure provides a relation between the precision and recall of the classification results (van Rijsbergen, 1979). First, we analyzed the performance of the kNN classifi- cation method for the authentication of each of the selected local bee pollen types in isolation. These results are obtained by classifying the test dataset with the train one-class classifiers. The classifiers are trained without rejecting any training instance as outlier (rejection thresh- old equal to 0%). Table 2 shows the evaluation measures of the classifiers for each pollen type. By observing figures of Table 2 we can conclude that the FP rate is almost 0. This means that the classifiers are able to correctly iden- tify all the outliers (non-local pollen types) without mis- classifying them as local pollen types. The FN rate is higher than the FP rate although its value is low, 9% in the worst case (Echium pollen type). Table 3 shows the performance measures of the final multi-classifier. In the first block of figures we show the accuracy and FP-FN rates when rejection threshold equals 0%. In the second block, a rejection threshold of 10% is used for obtaining the results. The kNN algorithm, with a rejection of 10%, is the model having the best results as it has low FP and FN rates, and has the highest accuracy. Finally, Table 4 shows the confusion matrix of the best multi-classifier configuration with a kNN algorithm with a rejection of 10%. The reader can see that, in general, there is no miss-classification between the known pollen load types. There is just one miss-classi- fied instance by the kNN multi-classifier. The highest error is in the right column. These are FNs because real pollen load type instances are classified as outliers (non-local pollen types). Nevertheless, as it can be seen in Table 2, the FN rate is low. From the results, we can also see that the tradeoff between FP and FN rates is better than in the isolated one-class classifiers. This fact comes from the confidence mechanism of the multi-classifier, able to discard instan- ces classified by one of the one-class classifiers as local pollen types when they are not clearly confident about their decision. Although accuracy is obtained when classi- fying all the classes (four known pollen types and out- liers), the FP and FN rates are calculated between the classification of the instance as known pollen type (one of the four known types) or as outlier. There is almost no error when classifying among local pollen types. Finally and by comparing the validation measures of the multi-classifiers and the one-class classifiers, it can be concluded that the overall results of the multi-classi- fier are better than the independent one-class classifiers. This fact indicates a good behavior of the whole fusion scheme for detecting the known pollen type classifiers. 3.3.4. Validation of the complete prototype The proposed software prototype includes the software methods to manage and create local pollen types, train the models, and validate the whole process. The soft- ware prototype was programmed in MATLAB using some functions of the DD tools library (Tax, 2011). Initially, the user needs to train the system with the known local samples. The user must manually separate Table 4. Confusion matrix of the multi-classification system formed by the four one-class kNN classifiers (one for each pollen type). Predicted pollen type Real pollen type Rubus Echium Cistus Quercus Outlier Total Rubus 248 0 0 0 33 281 Echium 0 357 0 0 43 400 Cistus 0 0 275 1 10 286 Quercus 0 0 0 48 1 49 Outlier 4 0 5 8 913 930 Total 252 357 280 57 1000 1946 10% of the training data were rejected as outliers during the training phase of the one-class classifier. Figure 11. Original image and resulting images after applying the mean shift algorithm (varying spatial bandwidth hs to 7, 15, and 30, respectively). 20 M. G. Campos et al. pollen types as shown in Figure 12. By using the diction- ary tool of the software prototype, the user can also save her/his local (known) types. See for instance Figure 13 where an entry called Rubus is introduced into the system. After performing the training phase of the sys- tem, a new incoming pollen samples can be processed to start with the automatic pollen loads separation by color. Some screenshots of the software application are provided in Figure 14. In these images, one can see the graphical user interface with the list of separated pollen loads by type, the entries of the dictionary, and final output of the multi-classification algorithm. 3.4. Concluding remarks The propose standard methodology used a chain of methods based on computer vision and classification techniques for authentication the origin of bee pollen loads. This process can be used to check and detect fraudulent samples. A one-class multi-classification scheme based on kNN and its merging scheme improve the accuracy of isolated classification methods and is able to provide a final global output. The best multi- classifier configuration, formed by kNN one-class classi- fiers, is able to achieve a 94% accuracy when detecting local pollen types. The model has been validated in 1946 colors instances for the authentication of four Spanish pollen types against different outlier samples. The use of the presented standard methodology drastic- ally reduces the time and effort spent by experts to sev- eral seconds and can be used as a standard method for macroscopically rejecting unknown pollen loads. Future work can be devoted to apply a more interpretable multi-classification system such as linguistic rule-based classifiers. In that way, the users of the standard method could understand the reason why a sample is rejected as known local pollen type. 4. Evaluation and classification of corbicular pollen morphology The evaluation of quality of the corbicular pollen is one of the areas which lacks unified and standardized evalu- ation systems. However, descriptors used in the evalu- ation of genetic resources of cultivated species of plants could be a suitable system for the evaluation and char- acterization of various types of corbicular pollen. Among other analyzes, the technical parameters of the corbiculae, may be an important marker for assessing the geographical and botanical origin and subsequently the nutritional quality of corbicular pollen. The industrial production, however, requires methods for the identifi- cation of corbicular pollen that can be systematically included into the production chain. What the plant spe- cies a corbicula is composed of, and what the plant com- position and their proportionality is in the overall pollen lay, are the indicators of the geographic and botanical origin of the corbicular pollen (Carrion et al., 2003). Briefly, the pollen color can distinguish the types of cor- bicular pollen and it mainly depends on factors such as pol- len maturity, moisture, drying, pigments and the actual plant source (No^zkova, Brindza et al., 2010). The authors suggest a variety of colors ranging from white, yellow, orange, red, with a greenish tint, to black and its shades. The works also present a common fact: the color of the flower pollen varies with the color of the corbicular pollen of the same plant species (Chica & Campoy, 2012; Reiter, 1947). The information regarding the size of corbiculae is very scarce in the literature. The authors mention the size only indirectly – either using the parameter of weight, or the number of pollen grains in one corbicula (Rodrıguez-Damian et al., 2006). The size, shape and surface of the pollen grains, the corresponding botanical origin, size of the openings in the pollen trap, beekeep- er's handling of the corbiculae after harvesting, etc., are all factors that have a decisive effect on the shape and Figure 12. Pollen load samples separated by an expert to train the system. Figure 13. Screenshot of the prototype pollen dictionary. The ambiguity discovery algorithm checks if there is an existing pol- len type having identical features compared to the new sample. Standard methods for pollen research 21 size of the corbiculae, and so also on its the quality. The ornamentation of the exina of the pollen grains can cause differences in the structure of the cor- bicula surface. 4.1. Characteristics of corbicular pollen samples The selected samples of corbicular pollen, frozen and store at the temperature of 11 C to 18 C, immedi- ately after collection. 4.2. Methodology for assessing the morphometric characters of corbicular pollen Quantitative and qualitative characteristics will be under evaluation of morphological parameters of corbicular pollen collected by the honey bees. For each character- istic is designed and defined the methodology of evalu- ation. Then a database of detailed image recordings is created. The corbiculae in each sample is placed on a glass slide using a fully automatic magnifying glass, for instance, Zeiss Discovery with a digital camera Figure 14. (a and b). Two screenshots of the prototype software detecting a local pollen type in the pollen load images. 22 M. G. Campos et al. AxioCam, or similar. The corbiculae are placed on the glass slide in the same direction. The upper part of the corbiculae in the image is always the depression created by placing the pollen around the bee leg inside the pol- len basket. 4.2.1. Methodological procedures for evaluating the quantita- tive characteristics In the selected quantitative traits evaluate the corbiculae by using the image analysis software Zeiss Axiovision or open source software like ImageJ with the correspond- ing modules (plugins) for automatic measurement (Figure 15). In the case of corbicular weight, conduct the measurement on precision analytical scales. The fol- lowing section presents the assessment methodology of quantitative characteristics, which were published in No^zkova, Ostrovsky et al. (2010). 1. Corbicula size. The size of corbiculae determines eight quantitative traits – bound height (mm), bound width (mm), Feret minimum (mm), Feret maximum (mm), shape index, symmetry, diameter (mm) and area (mm2). The methodological procedure for the assess- ment of these characteristics is based on the manual for the Axiovision software. a. Corbicula bound height. Indicates the height (in the y axis) of a bound square for the selected area. The square is drawn parallel to the x and y axis (Figure 16). Unit of measurement: mm. b. Corbicula bound width. Indicates the width (in the x axis) of a bound square for the selected area. The square is drawn parallel to the x and y axis (Figure 16). Unit of measurement: mm. c. Feret maximum and Feret minimum. This trait is based on the measurement of a minimum and a maximum distance. Two parallel lines are place on the opposite sides of the object in 32 posi- tions and evenly rotated by the respective angle (Figure 16). The corresponding distance is meas- ured in each position. The maximum value is Feret maximum and the minimum value is Feret minimum. Unit of measurement: mm. d. Shape index (bound width/bound height). This par- ameter is determined by calculating the two values. It is not expressed by any unit. It can be used only if the width and height of the corbicula has been correctly specified. The shape index helps us express the shape of the object. If the value is > 1, the object is flatter. If the value is < 1, the object is taller. If the value approaches 1, the object has a round shape – it is equally as wide as it is tall. e. Symmetry or Feret index (Feret min/Feret max). This is a parameter determined by calculating the two meas- ured values. It is not expressed by any unit. With this parameter, it is possible to express the shape of the object. Possible values range from 0 to 1. The values approaching 1 indicate the presence of compressed or round objects. Feret min and Feret max have approxi- mately the same value. If the parameter has a low value, the objects are long, elongate or oblong. f. Diameter. It is assumed that the measure area is a circle. This surface is then use as a basis to cal- culate the corresponding diameter. Unit of meas- urement: mm. Figure 15. Flowchart of image analysis. Figure 16. Evaluation of corbicula size characteristics. Standard methods for pollen research 23 g. Area. This is determined by the boundaries of the object by distinguishing the limit color of the object from the background (Figure 16). Unit of measurement: mm2. 2. Corbicula weight (mg). Each corbicula is weighed on accurate laboratory scales. From each sample select healthy and typical corbicu- lae. The minimum number is 5 and the maximum is 100 corbiculae per sample. 4.2.2. Methodological procedures for evaluating the qualita- tive characteristics For the evaluation of qualitative traits, the set of corbi- culae should be as big as possible, that it will cover the widest variability of the select characteristics. The quali- tative characteristics of the corbiculae can be evaluated visually in digitalized images. From each sample select healthy and typical corbiculae. A database of detailed recordings, should be done with a fully automatic macro magnifying glass, for instance, Zeiss Discovery with a digital camera AxioCam (or similar). The following sec- tion presents the assessment methodology of the quali- tative characteristics (No^zkova, Brindza et al., 2010). 1. Corbicula shape. For the evaluation of the corbicula shape, from three characteristics can be chosen: shape, heart shape and cutout depth. The variability in these characteristics is shown in Figures 17 and 18. 2. Corbicula surface. The variability in this characteristic is shown in the Figures 18 and 20. 3. Corbicula color. The color of the corbicula can only be assessed on samples of homogeneous color, i.e., samples of monofloral pollen. Color evaluate by using a visual color grading scale by Royal Horticultural Society (RHS) (2004) (or similar), which represents a universal color system with the respective color codes. 4.2.3. List of descriptors and classification 4.2.3.1. General structure of descriptors list. The list of descriptors designed for the evaluation of genetic resources of cultivated plant species have always been specifically attuned to a particular plant species or genus. Each list of descriptors consists of three main parts – the manual, passport descriptors and descriptors for evaluation and characterization. The manual contains the information on the structure and use of the descrip- tors, as well as the general principles for assessing the samples. The passport descriptors are designed accord- ing to the nature of the evaluated object and provide identification and passport data on the assessed sample. Figure 17. Evaluation of corbicula shape. Figure 18. Evaluation of corbicula heart shape. Figure 19. Evaluation of corbicula cutout depth. 24 M. G. Campos et al. The descriptors for evaluation and characterization are designed based on the study of variation in quantitative and qualitative characteristics. Using these descriptors, the morphological, biological and economic characteris- tics are evaluated. When creating a list of descriptors for the corbicular pollen, it will always be necessary to specify the type of insect involved in the creation of the corbiculae and the descriptors for characterization and evaluation will be designed specifically for the different types of monofloral pollen, the predominant plant spe- cies and especially in the case of multifloral corbicular pollen, according to the geographical origin (Figure 21). 4.2.3.2. Passports descriptors. The passport descriptors provide general information about the accession included in the collection and the management of growth (characterize by the collection method, storage and handling of the accession). The passport descriptors should define the mandatory information to identify the originality of the accession (Haussmann & Parzies, 2009). In the case of genetic plant resources, the pass- port data are exchange, and for the individual institutions to be able to communicate with each other, an international standardize list of Multi-crop passport descriptors (FAO/IPGRI, 2001) was created. To evaluate the quality of corbicular pollen, it is also necessary to design the passport descriptors, which will guarantee the authenticity and identify the specific prop- erties of the evaluated sample. What we consider to be the most important step is that the passport descriptors also determine the botanical and geographical origin. This means, it should be clear whether the pollen in question is monofloral or multifloral. In the case of mul- tifloral pollen, the geographic origin should be identified, which ensures the representation of specific plant species. Similar to plant species, even the corbicular pollen should have passport descriptors universal for all types of pollen. Despite the very high heterogeneity between the types of corbicular pollen, they should be designed in a way that they can be used to collect the necessary information be it in monofloral or multifloral pollen. The following section contains a draft structure of passport descriptors (Figure 22). The information on Figure 20. Evaluation of corbicula surface. Figure 21. Flow chart of the descriptors list structure. Standard methods for pollen research 25 the insect species or subspecies creating the corbiculae should come first. It should be followed by information on the collection by the beekeepers, i.e., the collection frequency, pollen trap characteristics, growing season and habitat characteristics. What is also important is the information on storage (method, length, tempera- ture and humidity) and pollen processing (moisture, dry- ing method). They should also include information on purity, i.e., presence of visible impurities, mold or whether the pollen comes from genetically modified plants (GMPs). The sensory characteristics such as fla- vor, color and taste, are also an important identifier of the specific characteristics and authenticity of pollen. 4.2.3.3. General structure of characterization and evaluation descriptors. A descriptor is an independent rating system for one specific characteristic. We use them to describe quantitative or qualitative characteristics. The structure of each descriptor is the same (Figure 24), which is a big advantage ensuring their universal use. Descriptors consist of a maximum of 9 classification grades (Figure 23). The minimum number of classification grades is two. Their number is proposed according to the observed variability in the characteristic. For each classification grade, the respective verbal description is proposed. In the case of quantitative characteristics, the individual classification grades should come with intervals (ranges). An important part of the descriptors is the assessment methodology with concise diagrams and pictures that describe the evaluation in detail. 4.2.3.4. Methods and techniques for creating and modifying the descriptors. A descriptor, which was included in the list of descriptors, covers the known variability of morphological, biological or economic characteristics and properties. If a new characteristic or trait is discovered in the future, which better character- izes and identifies the evaluated objects, the methods and techniques for creating new or modifying the exist- ing descriptors should be observed. In the next section we present the procedures and rules for the creation and design of various parts of the descriptor for the purpose of characterization and evaluation. a. Completeness. The descriptor grades should be designed to allow for any measured value or trait in the characterized sample to be included into the respective grade. This rule applies to both quantitative and qualitative characteristics (Table 5). In the case of quantitative characteristics, the intervals must be clearly defined. Also, a specification whether the range is open or closed should be included (Table 6). Figure 22. Descriptor structure. Figure 23. Visual representation of the line for the limit points xmin ¼ 1.81; xmax ¼ 4.26 and the coordinate “x4” to the point “y4.” 26 M. G. Campos et al. b. Unambiguity and uniformity. A descriptor is a ranking system with a clear identification of what, how, when, and to what extent it evaluates. An adequately designed methodology, pictures, diagrams and classifi- cation levels helps maintain the overall unambiguity. The descriptor should be used uniformly to evaluate the given characteristic. This means that all evaluators should use the same procedure for characterization and classification. c. Measurement ranges. In order to ensure the unambi- guity in the evaluation of quantitative characteristics (in the case of a continuous scale), the classification grades are recommended to be supplemented by ranges. By specifying the respective ranges, misinter- pretations in the characterization of samples are avoided. One of the ways to create the evaluation scales is using the principle of membership function in the fuzzy set (No^zkova et al., 2011). a. The first important step is to determine the limit val- ues in the given characteristic. This means that it is necessary to determine the minimum (xmin) and max- imum limit (xmax), which can be achieved in the eval- uated characteristic independent of the environmental conditions. b. Based on the defined limits, the equation is expressed as follows: The straight line is uniquely determined by two points (xmin, ymin); (xmax, ymax). [1] y ¼ ymin þ ymaxyminxmax  xmin x  xminð Þ In our case, xmin ¼ minimum limit and xmax ¼ maximum limit, ymin ¼ 0 and ymax ¼ 1 (Figure 23). Thus, the equation for the line is [2] y ¼ 1 xmax  xmin x  xminð Þ The above equation is used to express the vari- able "x" necessary to calculate the limit points of the individual ranges [3] x ¼ xmin þ xmax  xminð Þy c. The values of “y1” to “y19” (0.05, 0.1, 0.15 to 0.95) are then sequentially assigned to variable "y." The variable "x" represents the coordinate we are trying to find to the respective point "y" (Figure 23). The value of the variable "x" calculated according to Equation (2.3) is the limit point for the respective descriptor range (Figure 24). An illustrative example of 5 levels in a descriptor for the height characteristic where xmin ¼ 1.81; x max ¼ 4.26 and the value of “y1” to “y19” (0.05, 0.1, 0.15 to 0.95) were attributed to variable “y” (Tables 7–9). Figure 24. Flowchart of the passport data structure. Table 5. Descriptor for quantitative character – principle of completeness. Corbicula – height (mm) 1 Very small < 2.30 3 Small 2.30 2.79 5 Medium 2.79 3.40 7 High 3.40 3.89 9 Very high 3.89 and more Table 6. Structure of open and closed intervals in descrip- tor grades. Corbicula – height (mm) 1 Very small < 2.30 (0;2.30) 3 Small 2.30–2.79 (2.30;2.79) 5 Medium 2.79–3.40 (2.79;3.40) 7 High 3.40–3.89 (3.40;3.89) 9 Very high 3.89 and more (3.89;1) Table 7. Calculated value of variable “x.” x1 x2 x3 x4 x5 x6 x7 x8 x9 x10 x11 x12 x13 x14 x15 x16 x17 x18 x19 1.93 2.06 2.18 2.30 2.42 2.55 2.67 2.79 2.91 3.04 3.16 3.28 3.40 3.53 3.65 3.77 3.89 4.02 4.14 Table 8. Determination of limit points in ranges for five descriptor levels. x1 x2 x3 x4 x5 x6 x7 x8 x9 x10 x11 x12 x13 x14 x15 x16 x17 x18 x19 1.93 2.06 2.18 2.30 2.42 2.55 2.67 2.79 2.91 3.04 3.16 3.28 3.40 3.53 3.65 3.77 3.89 4.02 4.14 Standard methods for pollen research 27 4. Grading scales for qualitative characteristics. In the qualitative characteristics with a nominal range (color, shape, etc.), the classification grades are consecutive. Their number depends on the observed variability in the characteristic. The classification grade "9 – Other" is open to the newly detected variability in the characteristic (Table 10). In the case of ordinal scales (color intensity, etc.), the classification grades are not consecutive but fol- low the polarity of verbal characteristics (Table 11). In alternative characteristics, grade "1" refers to the absence of the given feature in the characteristic, and grade "9" refers to the full presence of the feature (Table 12). 5. Polarity of verbal description. In the descriptors for quantitative characteristics, it is necessary to follow verbal polarization (Figure 25). This means that the classification grade 1 represents something extremely small and grade 9 something extremely large. 6. Descriptor name. The name of the descriptor should be concise, it should accurately determine the evalu- ation area and it should be integral. The name should employ correct terminology and its structure should be uniform throughout the list of descriptors (Biodiversity International, 2007). 7. Evaluation methodology. The methodology should contain the evaluation details, i.e., how much material from the sample is to be assessed in order to get a representative result, what the assessment period is, as well as other information specific to the given characteristic (Table 13). 8. Drawings and pictures. It is appropriate that the meth- odology be supplemented with concise diagrams, drawings and pictures. These help the evaluator to clearly and consistently determine the correct classifi- cation grade in the descriptor and to avoid confusion caused by undesirable side effects. 5. Identification of the floral origin by microscopy Pollinic analysis by microscopy is one of the first steps and one of the very important because once the pollen morphology is identified, it is possible to infer the char- acteristics of the geographical regions where the BP was obtained, as well as the habitat of forest, fields and crops (Barth et al., 2010; Corbi et al., 1985; Dias et al., 2012; Rodrıguez-Damian et al., 2006). This method is based on two stages: the first consists in the identifica- tion of the pollen grains that are under observation and the second one aims to count them (http://www.apiser- vices.com/abeille-de-france/articles/pollinic_analysis.htm). Pollinic analysis allows scientists to infer the vegetation present in the area and to date and ascertain any bio- diversity changes, as for example, the presence and dis- tribution of invasive or exotic plants. Also, allows the scientists to distinguish if the pollen is monofloral, biflo- ral or multifloral, or if the pollen grains present differ- ent color means that belongs to different botanical species (Nogueira et al., 2012). The application of Pollinic analysis in paleoclimatic reconstruction has been reported (Li & Flenley, 1999; Rodrıguez-Damian et al., 2006). Some other studies revealed that BP analysis provides important information about the plant prefer- ences of honeys bees (Chaturvedi, 1973). Therefore, BP Table 9. Ranges of 5 descriptor levels for height. Grade Verbal characteristics Intervals 1 Very small < 2.30 3 Small 2.30–2.79 5 Medium 2.79–3.40 7 High 3.40–3.89 9 Very high 3.89 and more Table 10. Descriptor for qualitative character – structure of grades. Corbicula – heart shape 1 Elliptical 2 Spherical 3 Heart-shaped 9 Other Figure 25. Polarity in verbal description. Table 11. Descriptor for qualitative character – structure of grades in the case of ordinal scale. Corbicula – cutout depth 1 Very deep 3 Deep 7 Shallow 9 Very shallow Table 12. Structure of alternative character. Corbicula – presence of visible impurities 1 Absent 9 Present 28 M. G. Campos et al. Table 13. Complete descriptor with methodology and pictures. Grade Verbal characteristics Figures 3 Smooth 3 5 7 5 Moderately rough 7 Rough Methodology: Evaluate not less than 50 undamaged pollen corbiculas. Table 14. Descriptor for characteristic – corbicula – height (mm). Grade Verbal characteristics Range Figure 1 Very low 3 Low 5 Moderately high 7 High 9 Very high Methodology: Evaluate at least 50 undamaged corbiculae, to two decimal places. The Figure shows the height (in the direction of axis y) of a bounded object. Table 15. Descriptor for characteristic – corbicula – width (mm). Grade Verbal characteristics Range Figure 1 Very narrow 3 Narrow 5 Moderately wide 7 Wide 9 Very wide Methodology: Evaluate at least 50 undamaged corbiculae, to two decimal places. The Figure shows the width (in the direction of axis x) of a bounded object. Table 16. Descriptor for characteristic – corbicula – Feret maximum (mm). Grade Verbal characteristics Range Figure 1 Very small 3 Small 5 Medium 7 Large 9 Very large Methodology: Evaluate at least 50 undamaged corbiculae. Standard methods for pollen research 29 load analysis indicates the behavioral pattern and sense of selection of plants for food (Sharma, 1970). Moreti et al. (2002) referred that allows the identification of the major pollen sources used by the bees, as well as the periods of pollen production in the field and pos- sible times of shortage. By another side, Arroyo et al. (1986) referred that the determination of the flora where the bee products are originating is certainly of great interest to plan rationally the exploiting of natural resources. This knowledge allows us to know the geo- graphic origin of these products, so avoiding counter- feits of origin (Ricciardelli, 1982). While these analyzes (Melissopalynology) are important to the aspects men- tioned above, it’s important to highlight that the process of counting and classification of pollen grains are much laborious and time consuming due to the fact that they are done manually by highly skilled experts. Therefore, a high level of training is required for obtain reliable identification results (Rodrıguez-Damian et al., 2004, 2006). The classification of the different aspects of the structure used to the analysis of pollen by microscopy will be referred in Section 5.3 and complement the full characteristics. Accordingly to the Dictionary.com (http:// dictionary.reference.com/browse/pollinic), pollen is defined as “male grain gametophyte generation of seed- bearing plants. In gymnosperms, each pollen grain also contains two sterile cells (called prothallial cells), thought to be remnants of the vegetative tissue of the male gametophyte.” 5.1. Structure of the pollen grain Pollen is a granular mass of male reproductive cells pro- duced in the anthers of a flower. A pollen grain is a liv- ing cell surrounded by two protective coats, the intine and exine. The cell contains cytoplasm and nucleus. On the surface are apertures or germinal pores or furrows. The detail structure of a pollen grain and pollen grain wall is shown in Figures 26 and 27. The inner layer or intine is thin, delicate and very elastic. It is semi-perme- able membrane and does not stain. When the grain is seen in section, the intine can be recognized as a thin, clear line surrounding the cell contents. The outer layer exine is thicker, more brittle, and often variously sculp- tured or provided with various modifications such as spines, outgrowths or reticulations. The exine is made of an extremely durable material called sporopollenin and is composed by four layers, as listed below: 1. Base: This is a clear, uniform layer, the outer part of which can be stained to reveal a dark line in the optical section of the grain; 2. Rods or columns: These are arranged radially from the base; 3. Tectum: This layer forms a roof over the rods. It may be an incomplete layer, leaving some of the rods free-standing; 4. Ornamentation. This is provided by a layer of spines, outgrowths, reticulation, and other processes on the tectum. Usually, all the layers are not present. Those which are present, show many modifications that are very use- ful in identifying a particular pollen grain. Apertures are present on the surface of pollen grain. These are formed by the thinning or the absence of same of the layers of the exine. They are called furrows Table 17. Descriptor for characteristic – corbicula – Feret minimum (mm). Grade Verbal characteristics Range Figure 1 Very small 3 Small 5 Medium 7 Large 9 Very large Methodology: Evaluate at least 50 undamaged corbiculae. Table 18. Descriptor for characteristic – corbicula – shape index (width/height). Grade Verbal characteristics Range 3 ellipsoidal <0.9 5 spherical 0.9–1.2 7 heart shaped 1.2 and more Methodology: Evaluate at least 50 undamaged corbiculae. Table 19. Descriptor for characteristic – corbicula – sym- metry (Feret min/Feret max). Grade Verbal characteristics Range 1 Unsymmetrical 0 0.81 9 Symmetrical 0.81 1 Methodology: Evaluate at least 50 undamaged corbiculae. 30 M. G. Campos et al. Table 20. Descriptor for characteristic – corbicula – area (mm2). Grade Verbal characteristics Range Figure 1 Very small 3 Small 5 Medium 7 Large 9 Very large Methodology: Evaluate at least 50 undamaged corbiculae, to two decimal places. The area is determined by the boundaries of the object by distinguishing the limit color of the object from the background. Table 21. Descriptor for characteristic – corbicula – weight (mg). Grade Verbal characteristics Range 1 Very small 3 Small 5 Medium 7 Large 9 Very large Methodology: Evaluate at least 50 undamaged corbiculae. Table 22. Descriptor for characteristic – corbicula – texture. Grade Verbal characteristics Figures 3 Smooth 3 5 7 5 Moderately rough 7 Rough Methodology: Evaluate not less than 50 undamaged pollen corbiculas. Table 23. Descriptor for characteristic – corbicula – shape. Grade Verbal characteristics Figures 1 Irregular 2 Spherical 3 Ellipsoidal 4 Heart shaped 9 Other 1 2 3 4 Methodology: Evaluate not less than 50 undamaged pollen corbiculas Table 24. Descriptor for characteristic – corbicula – heart shape. Grade Verbal characteristics Figures 1 Ellipsoidal 1 2 3 2 Spherical 3 Heart shaped 4 Other Methodology: Evaluate not less than 50 undamaged pollen corbiculas. Standard methods for pollen research 31 or colpi, if they are elongated and tapering toward the end or pores when they are round or oval (Figure 28). The furrows run longitudinally with their ends toward the polar areas. The apertures are generally situated on the equator but pores are often found scattered over the whole grain surface. Pores and furrows often occur together, but at different levels of the exine. Apertures allow the grain to dry or to absorb water and thus to change into an expanded state. Also provide an easy outlet for the pollen tube when the grain germinates. Therefore, they are also called germ pores or germi- nal furrows. 5.2. Floral origin Considering the bee pollen loads, pollen may be classi- fied as: 1. Unifloral, also named monofloral, when this product is derived from a single botanical source (Campos et al., 2008); 2. Bifloral when obtained from two species of bee plants; 3. Multifloral, also named heterofloral or plurifloral, when the pollen originates from several botanical spe- cies (Barth, 2004; Campos et al., 2008; Sharma, 1970; Stanley & Linskens, 1974). 5.3. Features of pollen grains Each pollen grain has its own peculiar structural fea- tures (size, shape, apertures type, exine sculpture (exine ornamentation) and surface and other features), which helps us recognize its origin. Scientists-palynologists Sawyer (1981) and Vorwohl (1990) have different opin- ions of these features. Some of them will be show along the text. 5.3.1. Size The size (diameter) of the pollen grain is expressed in microns or micrometers (mm), where 1 mm ¼ 1 / I 000mm. The maximum diameter of a pollen grain includes the spines or other ornamentation. Sawyer (1981) used five size classes: 1. Very small (<20 mm); 2. Small (20–30 (mm); 3. Medium (30–50 mm); 4. Large (50–100 (mm); 5. Very Large (>100 mm). However, not all pollen grains are round. Many are either elliptical or triangular, even elongated. Vorwohl (1990) suggested that instead of defining size by the diameter, it should be defined by the length and breadth and defined nine classes of length and width (Table 28). 5.3.2. Shape Shape is the outline; the optical section seen under the microscope and has been considered as an important feature in pollen identification (Sawyer, 1981). A pollen grain can be round, oval, elongated, triangular, semi-cir- cular or boat-shaped, and irregular or multi-sided. The shape plays a very minor role in the identification of pollen grains, because it varies depending upon the Table 25. Descriptor for characteristic – corbicula – cutout depth. Grade Verbal characteristics Figures 1 Very shallow 3 Shallow 7 Deep 9 Very deep 1 3 7 9 Methodology: Evaluate not less than 50 undamaged pollen corbiculas. Table 26. Evaluation of corbicular color (No^zkova, Brindza et al., 2010). Sample no. Color (Visual assessment) Color group name (RHS) Color (RHS) 2 brownish yellow gray-yellow 162 A 5 grayish green gray-green 194 A 66 brown brick gray-orange 165 B 80 lemon yellow yellow 8 A 81 brownish yellow gray-yellow 162 A 90 brownish yellow gray-yellow 162 A 98 brownish yellow gray-yellow 162 A 99 brownish yellow gray-yellow 162 A 100 carrot orange orange 24 A 113 brownish yellow gray-orange 164 B 32 M. G. Campos et al. Table 27. Descriptor for characteristic – corbicula -color. Grade Verbal characteristics 1 Black 2 Purple 3 Brown 4 Green 5 Orange 6 Yellow 7 8 9 Other Figures 2 purple hue 3 brown hue 4 green hue 5 orange hue (Continued) Standard methods for pollen research 33 position in which the grain lies and upon the viewing aspect (polar view or equator view). Many grains appear round in one particular aspect. If they also show special characteristic shapes, these have been given preference in the key. These alternative shapes should be used for identification. In addition to the definitely triangular or tri-lobed appearance of many grains, other 3-furrowed grains may show a shape intermediate between rounds and triangular. Both these classifications should then be considered. 5.3.3. Apertures Pollen grains have apertures on the surfaces. The shape (type) and the numbers of apertures are important characteristics of a pollen grain and can be used in iden- tification. Furrows containing pores are counted as one aperture. In compound pollen grains, the numbers refer to each single grain sub-unit. Nine classes of aperture number (as given in Table 28) can be used in pollen identification. Regarding aperture type, Vorwohl (1990) used the following five classes in pollen identification (Table 28). Whereas Sawyer (1981) recognized only four classes of aperture types to be important in pollen identification as: 1. Pores only; 2. Furrows only; 3. United pores and furrows; 4. Irregularly occurring furrows. 5.3.4. Exine sculpture (exine ornamentation) and surface The exine, the outermost coat of the pollen grain, is either smooth or various ornamented with different outgrowths or projections, such as granules, various kinds of spines, and reticulum or window-like struc- tures. The ornamentation of the exine has a major Table 27. (Continued). Grade Verbal characteristics 6 yellow hue Methodology: 1. Visual assessment: the most frequent corbicula color is taken into account and the corbicula is assigned its respective classification grade. 2. Evaluation using RHS: the methodological rules set out in this classification system are observed. After determining the color of the sample, the respective code (e.g., 164B) is recorded. Figure 26. Diagrams showing the structure of a pollen grain in optical section (Sawyer, 1981). Figure 27. Diagrams showing details of pollen grain walls (Sawyer, 1981). Figure 28. Diagrams illustrating the morphological regions of a pollen grain and pollen grain apertures: (a) equatorial view; (b) polar view (Sawyer, 1981). 34 M. G. Campos et al. effect on the surface of pollen grain as viewed under the microscope. The surface of pollen grains, as seen under the microscope, can sometimes change with a change in focus. For example, the pollen grain of Luffa cylindrica may appear granular under one focus and reticulate under another. 1. Nine classes of exine ornamentation can be identify: thin; medium, no rods; medium with spaced rods or beaded; medium or thick with coarse external rods; layer of closed thin rods; long thin spines; large broad- based spines; small or very small spines; or warts and other projections. 2. Five classes of surface as: smooth or indefinite; granu- lar or warts; striated; net or pitted and Isolated dots due to spines or other projections. (exine ornamenta- tion can also be divided into seven classes of exine sculpture – Table 28): a. Psilate, Faveolate and Fossulat: When exines are smooth, they are known as psilate, e.g., Betula spp and Pyrus spp. Exine sculpture with little pits is reported as faveolate and is known as fossulate with relatively larger pits. In viewing the surface, the pollen grains with psilate, faveolate, and fossu- late exine sculpture appear smooth or some- times indefinite; b. Scabrate, Verrucate and Gemuate: Exines with little warts and diameters of not more than one pm are scabrate, e.g., some species of Quercus. In verrucates, the diameter of the warts is more than one pm, e.g., members of the Ranunculaceae family, some Asteraceae, and Nigella spp. Gennuate is an exine sculpture with round warts which are narrower at the base, for example, Ilex spp. In optical sections, this kind of exine appears to have small projections. Pollen grains with this kind of exine sculpture appear granular in viewing the surface; c. Echinate: Exines provided with different kinds of spines, e.g., Malvaceae, Cucurbitaceae, Campanulaceae, and many Asteraceae are echinate. Pollen grains with echinate exine sculpture appear to have dots on the surface; d. Clavate and Bacculate: Exines with rods which have thicker ends are clavate and those with stick-like rods are bacculate. Pollen grains with clavate or bacculate exine sculptures are very rare. On examining the surface, the pollen grains with this kind of exine sculpture appear granular (they have larger grains than scabrates, verru- cates, and gennuates); e. Rugulate and Striate: Exine sculptures with stria- tions, e.g., species of Acer, Prunus, Datura, and Fragaria, belong to these categories. In optical section, the exines appear to have close, thin rods. On examining the surface, the pollen grains also appear striated; f. Reticulate: This term is used when the exine sculpture is reticulate or net-like. This category is divided into fine reticulate, or beaded, or coarse reticulate. Examples are Lilium spp, Hedera helix, and Ligustrum spp. In optical sections, reticulate exines appear to have either thin or coarse rods, or they appear to be beaded. Pollen grains with reticulate exine sculpture appear reticulate on the surface also; g. Fenestrate: Exines in which there are window-like holes between the ribs of the exine belong to this category. Important examples include Taraxacum officinale (Ap.: and members of Amaranthaceae). On the surface, the pollen grains appear to have window-like holes. 5.3.5. Other features According to Vorwohl (1990), aggregation of pollen grains is one of the important features in identifying pollen grains. Pollen grains of some plant species have other diagnostic features. For example, the pollen grains of many plant species in the family’s Ericaceae and Table 28. Diagnostic pollen grain features used for identifica- tion (Vorwohl, 1990). 1. Length and breadth 1 <10 mm 2 10–15mm 3 15–20mm 4 20–25mm 5 25–30mm 6 30–35mm 7 35–40mm 8 40–50mm 9 >50 mm 2. Aperture number 1 2 3 4 5 6 7 8 >7 9 Absent or not clear 3. Aperture type 1 Pore 2 Colpa 3 Heterocolpa 4 Syncolpate 5 Heterocolporate 4. Exine Sculpture 1 Psilate, Faveolate, Fossulate 2 Scabrate, Verrucate, Gennuate 3 Echinate 4 Clavate, Bacculate 5 Rugulate, Striate 6 Reticulate 7 Fenestrate 5 Aggregation 1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 >7 Standard methods for pollen research 35 Leguminosae (sub-family, Mimosoidae) are polyads, i.e., compound. In Ericaceae, four grains are aggregated to form a tetrad, e.g., Rhododendron spp., whereas in the Leguminosae, eight, twelve, or sixteen pollen grains are aggregated to form a polyad, e.g., Acacia spp, Albizia spp, Calliandra spp, and Mimosa spp. Also another important feature for pollen determining as: Air sacs; Thickened or projecting edges to apertures; A cap or streak on the apertures; Granules or projections scattered on the apertures; Intine swollen below the apertures; Intines thick or very thick and cell content’s granular has been reported by Sawyer (1981). 5.3.6. Irregular grains In the study of pollen found abnormal, not typical, grains. Sawyer (1981) allocates such grains in the follow- ing groups: 1. Shriveled or abortive grains. Particularly in Rubus (blackberry), Trifolium repens (white clover) and many garden cultivars (e.g., Saxifraga and Oxalis) we find shriveled grains which do not expand when mounted. Such grains may even form the majority in a sample; 2. Giant and dwarf grains. Many pollen samples show the occasional giant grain; much larger than usual and often irregular. Others, for example Plantago (plantain) and Fagopyrum (buckwheat), produce a number of unusually small perfect grains among their pollen; 3. Aperture numbers. Variants with 4 furrows are occa- sionally found among 3-furrowed grains. This is par- ticularly noticeable in some of the Rosaceae (e.g., blackberry and fruit blossom), Rumex (dock) and Hippophae (sea buckthorn). Regular variation of the number of pores is found in Carpinus (hornbeam) (3, 4 or 5); Alniis (alder) (4, 5 or 6) and Epilobium angustifo- lium (rosebay willowherb) (3 or 4); 4. Abnormal furrows. An interesting variation occurs in Veronica (speedwell) and occasionally in other Scrophulariaceae. This results in a square grain (PI. 188). Irregular and united furrows are common in Hypericum while the 'furrows' of Berberis (barberry), Crocus and Populus (poplar) appear as irregular breaks in the exine rather than true furrows (Crocus). The study of atypical pollen grains used for palinoindication of environment. (See also the paragraph regarding to Palinoindication of environment). 5.3.7. Pollen “types” Although the pollen from each species of plant differs from that of all others, the differences are often slight and with the multitude of plant species and hybrids in the world, it will be appreciated that we cannot expect to identify each one by its pollen alone. Here they are group according to their “type.” The pollen of some species is unique in its charac- ters. Thus, Trifolium repens (white clover) and Trifolium pratense (red clover) may be distinguished from one another and from all others. But more often we find a “type” of pollen common to a genus or other group of plants. The pollen of all Tilia (lime) is unmistakable and although careful study may indicate the particular Figure 29. Photos to illustrate the variety of colors of pollen loads of different species of plants: (a) gray – Vicia faba; (b) lemon yellow – Brassica napus; (c) dark gray – Papaver rhoeas; (d) blue – Phacelia tanacetifolia; (e) mixed yellow pollen – mixed pollen from fruit trees (Prunus, Pyrus, Malus) and bright orange – Taraxacum officinale. 36 M. G. Campos et al. species, the classification “Tilia type” is usually sufficient in limiting. 5.4. Colors of pollen The colors of bulk pollen, dry from the anthers or the pollen loads of bees, have been arranged in spectral order. They show considerable variation but may at times provide a valuable clue to identity (Hodges, 1952; Kirk, 1994; Partap, 1997; Sawyer, 1981). Hodges (1952) and Kirk (1994) consider that the first steps for identifi- cation of pollen loads are 1. sorting by color; 2. selecting one or two pollen loads from each color group; 3. pollen loads are put on white paper and lightly patted to make a uniform flat surface. This is necessary in order to find an exact match to a known color chart. The nice color charts in Hodges (1952) and Kirk (1994) illustrate the different color pollen loads of dif- ferent plants. The Figure 29 presents an example of the different colors of pollen loads. Important is the lighting, in which the identification is carried out. Pollen loads that are to be identified must therefore be matched to the color chart under these same standard conditions. If the chart is used in direct sunlight or under electric light, the result may well be different. According to Kirk (1994), many plant species have pollen loads with very similar colors, so the particular species from which a pollen load has been collected can rarely be identified from just the pollen color. However, a combination of the color, flowering time and knowledge of local plants can usually narrow down the possibilities to one or a few species. However, this identification cannot be accurate. Therefore, for more exact identification microscopic examination pollen grains is necessary. For instance, it has been proved that the color of pollen influences the color of honey; pollen and pollen loads from Taraxacum and Helianthus annus are bright orange – the color of pure honey with this plants – also is bright orange; pollen from Phacelia – blue, pure honey from Phacellia as a pale-blue color, pollen loads from Aesculus hippocastanum give a burgundy, honey with red- dish color, etc. Most of the loads collected by honey bees consist only of pollen, but bees also collect prop- olis and occasionally fungal spores and various dusts (Hodges, 1952). 5.5. Methods of pollinic pollen analysis 5.5.1. Types of microscopy examination The exact definition of the botanical origin of bee prod- ucts, especially honey and bee pollen, requires the use of microscopic examination. The literature describes three methods of microscopic procedures. 5.5.1.1. Light microscope.  Use a light microscope at a magnification of which is 100, 500, 1000 makes it possible to determine the external characteristics of the pollen grain: the shape, size, surface sculpture, and the presence of pores, fis- sures, etc.). And identify it up to the family, genus and species (Tripathi et al., 2003). But this method has its drawbacks: the internal structure of the grain is unattainable because of the opacity of the outer shell (exine) and pollen grains of some plants are too large and therefore it is impossible to get a clear image.  Preparation of pollen analysis for microscopic prepara- tions. There are several techniques, which differ mainly in the medium fixing pollen grains turpentine, alcohol, honey solution or acetolized method (Dustman, 1992). Since the methods of preparation of pollen in micros- copy greatly affect the appearance of pollen grains and noted the difference in the results of analysis, it is advisable to reference preparations of pollen grains and pollen description made in a relatively simi- lar procedure. Louveaux et al. (1978) proposed an affordable and sim- ple method for the preparation of dust melisopalinology research involves the use of glycerol-gelatin. This method is used in many countries. 5.5.1.2. Transmission electron microscope (TEM).  Microscopic examination of pollen using a transmission electron microscope, which allows the study the ultra- thin sections of pollen grains;  The image has pollen with unlimited depth transparency (X-ray allows us to study the internal structure of an object is significantly different than the other methods) (Kedves et al., 2002, 2003; Laere et al., 1969). 5.5.1.3. Scanning electron microscope (SEM) (three- dimensional image). Accuracy to distinguish varieties even within the same species of plants. Especially for minor differences in the size and structure of the sur- face of pollen grains of different varieties of fruit crops (Brindza & Brovarskyi, 2014; Fogle, 1977; Klungness & Peng, 1983; Lindtner, 2014). At the present stage of research melisopalinologiy widely practiced a combination of all methods of microscopy (Tripathi et al., 2003). For carrying pollen analysis must have reference preparations of pollen grains of the plants that could potentially occur in the samples of pollen, keys and atlases pollen. Help in defin- ing various botanical origin keys pollen grains photo- graphs, drawings. Modern pollen atlas published in 2004 by German melisopalinology. It contains pictures and descriptions of pollen about 170 species of plants and honey flora characterizes his country (Bucher et al., 2004). Several studies focused on computerized texture analysis of Scanning Electron Microscopy (SEM) images have been published (Langford et al., 1990; Li & Flenley, 1999). Standard methods for pollen research 37 5.6. Microscopic techniques Identification of pollen is carried out in 3 stages. 5.6.1. Preparation of pollen grain slides from pollen loads for microscopic research Method of preparation of pollen grain slides based on the method of mellisopalinology Louveaux et al. (1978). 1. Take 1mg of bee pollen loads with tweezers and transfer to a glass slide, add a drop of distilled water, which cement pollen grains will be separate each other. The amount of water is such that pollen grains freely melt away in a single layer on a slide. 2. Evaporate the water. 3. Apply one drop of warm (þ40 C), heat by thermal table glycerin-gelatin and cover with cover slip. 4. Preparation of glycerin jelly. Weight 10 g of gelatin and place them place for two hours in distilled water (gel- atin absorbs 34.2ml of water) and add 66.3 g of gly- cerin. This ratio of ingredients allows to save pollen grain shape unchanged. To prevent microbial growth in glycerol-gelatin add 0.5 g of carbonic acid (phenol) and to get a clear picture of the structures of pollen grains – 0.1 g Basic Fuchsine. 12 hours later for the prevention of further drying up of the slides aids its conservation – edge of the coverslip treat with dec- orative lacquer (nail polish). 5.6.2. Identification of pollen under microscope Determination of botanical species of pollen can be done using the computer program identification of pol- len LUCIA (Rodlauer & H€uttinger, 1992) (or similar). As an example, Digital camera Sony with light micro- scope Nicon transfer image of pollen on the computer screen. The operator determines the size, shape, num- ber of pores, fissures and other parameters of the pol- len grain – creates a digital key for determine (details in Introduction). Using this key, another computer pro- gram (electronic database of pollen) "Pollen Data Bank," provides a search and similar pollen grains select and begins clarification of affiliation pollen to a particular plant species. For comparison also use own standard slides and/or slides from other collections as, for example, the collection of the Austrian Institute of Beekeeping. Determination of the botanical origin of pollen will be performed by comparing investigational pollen grains with descriptions and photographs of existing atlases and reference books, as for instance: Ambruster and Oenike (1929), Burmistrov and Nikitina (1990), Faegri et al. (1993), Fossel and Pechhacker (2001), Hodges (1952), Maurizio and Louveaux (1965), Sawyer (1981) and Zander (1935). Microscopic magnification of X 450 (Zea mays) and 1000. For the magnification of 1000 used oil immersion (cedar oil). A calibration line representing 10mm should be add to each photograph. 5.6.3. Description of pollen grains Description submitted by the following scheme: 1. Latin name of the plant; 2. The family of plant; 3. Plant life form (tree, shrub, herb; an annual or peren- nial plant); 4. Morphological characteristics of pollen grains: a. size of the diameter and the equator; b. number of furrows, pores; c. surface and exine sculpture; 5. Color of bee pollen loads. 5.7. Palinoindication of environmental pollution The knowledge of the morphology of pollen grains from different species (plants) allows simultaneous pollen ana- lysis of bee products, also to carry out environmental monitoring, determine ecologically disadvantaged regions. It has been proved that the formation and development of pollen is very sensitive to external fac- tors (radiation, volcanic activity, solar activity, heavy metal contamination, etc.) (Bogdanov et al., 2005). The result is a significant amount of pollen grains with modified morphological structures. Research shows that in harsh conditions, plants may produce large amounts of atypical imperfect, irregular and abnormal pollen grains - the worse the state of the environment, the greater the percentage of abnormal pollen and vice versa. (Bessonov, 1992; Dzyuba, 2006, 2007; Dzyuba & Tarasovich, 2001; Gilber & Lisk, 1978; Glazunov, 2001; Muszynska & Warakomska, 1999). 5.8. Concluding remarks Research using light and scanning electron microscopy show the changes in size and shape of the pollen grains, the number, the shape and type of apertures, their size and location relative to each other. Main thing changes the most stable structure of pollen grains – sporoderm surface structure (shell), the number and thickness of the layers. Russian scientists have developed a method for determining the quality of the environment by the number of abnormal, atypical pollen grains (Dzyuba, 2006). In selected samples investigated at least 200 pol- len grains, each of which is examined by the follow- ing parameters: 1. The form of the pollen grain; 2. The size of the pollen grain; 3. The number of apertures; 4. The nature of the location and type of apertures; 5. The thickness and number of layers sporoderm; 6. The nature and type of sculpture sporoderm; 38 M. G. Campos et al. 7. Symmetry breaking pollen grain. Thus, each sample was fixed in the presence/absence teratomorfic (pathologically developed) pollen grains, their quantity and analyzed morphological features. The Figure 30 illustrates the typical, normal pollen grains. Pollen grains have no deviations in the morphological parameters (size and shape of grains, number, shape and type of apertures, their size and location relative to each other, the sculpture's surface the number and thickness of layers). In the Figure 30 presents the pho- tographs of pollen grains morphological features which correspond to norm. Photos made with the help a scan- ning electron microscope (Figure 30) and the Figure 31 shows some pollen grains (scanning electron micro- scope) with changed morphological structures. Particularly large number of abnormal pollen grains in Phacelia tanacetifolia (atypical shape and size) (Figure 31a). Pollen grains of Taraxacum officinale observed sym- metry breaking (Figure 31b) (Lokutova, 2014). Therefore, numerous experiments have shown that during pollen analysis of bee products to determine their botanical and geographical origin there is a possi- bility at the same time estimate the state of the environment. According the quantitative content abnor- mal pollen grains can draw conclusions about environ- mental situation in the region, where these bee products were received. 6. Phenolic and polyphenolic profiles as fingerprints of floral origin of bee pollen Rapid and easier method developed by Campos et al. (1997) use High Pressure Liquid Chromatography/ Diode Array Detector (HPLC/DAD) profiles, of phen- olic and polyphenolic compounds, made with hydroalco- holic extracts of pollen and bee pollen loads. It is easy to do, reliable, highly effective, and requires minimum sample preparation, as indicated by the several reports, from worldwide, in which the method has been used to analyze the phenolic composition of pollen. This method allows the identification of the genus and the species (sp.) and provides valuable information related to chem- ical structure of the constituents under analysis. The phenolic acids and polyphenolics in pollen are expressed as specie-specific, which represents an important tool for taxonomy studies. It should be do a screening of dif- ferent color pellets from a mixture of bee pollen and the identification of the potential floral source using a Figure 30. Typical (normal) pollen grains (scanning electron microscopy): (a) Aesculus hippocastanum; and (b) Vicia faba. Figure 31. Pollen grains with changed morphological structures (scanning electron microscopy): (a) Phacelia tanacetifolia; (b) Taraxacum officinale; and (c) Scilla bifolia. Standard methods for pollen research 39 data base build with floral hand collect pollen or herbar- ium specimens. The first approach to the flavonoid structures can be based on Campos and Markham the- ory (2007). 6.1. Materials and methods 6.1.1. Sample management Sample management is an important issue for the ana- lysis. It is essential to specify details about where and when specific pollen samples are collected, sample stor- age, handling, and preparation, as details of any of these aspects might affect the phenolic composition of pollen. More details found in Section 2 of this chapter. 6.1.2. Sample collection 6.1.2.1. Pollen hand collected – reference samples. Reference samples should be collected from the specimens at the Herbariums if they show a very good preservation or they can be hand collected from the sta- mens of flowers at the field and bring to the laboratory. The correct taxonomic identification should be assured. The HPLC/DAD fingerprints of the phenolic and poly- phenolic compounds of these well-known samples will be used as a data base for match of the unknown samples of bee pollen. For that, it is important to: 1. record location of harvesting; 2. record date of sampling; 3. collect the respective voucher specimen, which must to be deposited at herbarium to be identified or authenticated. 6.1.2.2. Bee pollen pellets/loads. Samples collected dir- ectly from bee pollen traps or purchased from beekeep- ers during the collection period. Information about the apiary locations and harvesting data is always welcome, as well the processing of drying, if it was applied. 6.1.3. Methods 6.1.3.1. HPLC/DAD analyses. 6.1.3.1.1. Sample preparation (hand collected pollen and/or pollen from herbarium). 1. Weight ten milligrams of dried pollen of each sample. If the sample is from herbarium lower amounts can be used but the proportion 10mg to 1000 ml should be maintained. Note: Using always the same concentration among samples makes easy to compare the approximate amount of phenolic and polyphenolic compounds in the fingerprints, without the need of quantification. If need, a rigorous determination of the total amounts of each compound can be done, using a calibration with standard solutions. 2. Add an ethanol (EtOH)-water solution (1ml, 50% V/V). 3. Sonicate for 60min. 4. Centrifuge the resultant extract at 5000 rpm for10min. 5. Take out the supernatants and do a microfiltration with a 0.45 mm membrane for HPLC/DAD analysis as previously described (Campos et al., 1996). 6.1.3.1.2. Sample preparation (bee pollen). Usually bee pollen samples are made up of different color loads/pel- lets and set up a “multifloral bee pollen.” However, “monofloral” samples are also found in the market and/ or produced with this purpose according to Campos et al. (2008). 1. Separate pollen loads by colors (Figure 32). Note: commonly each color corresponds to a botan- ical origin and, for each one, it will be carried out a HPLC/DAD profile (fingerprint of the taxon). This fin- gerprint will be compared to others in the data base to obtain the match with a similar one. 2. Weight one pellet, keeping the same ratio for extrac- tion (10mg/ml EtOH 50%), for instance, if the weight is 6.78mg the solvent will be 0.678ml of EtOH 50% (V/V). 3. Proceed the same way for mixtures of bee pollen. The extraction should keep the same ratio. If necessary, du an aliquot that represents the entire weight of the sample under analysis, for example, 10 g/l EtOH 50% (V/V). The portion of the mixture to be weighed is removed after sample homogenization. 4. Proceed as explained in points 3–5 in sSection 6.1.3.1.1. Note: In addiction a standard of quercetin-3,5,7,30,40- O-pentamethyleted can be add to samples for HPLC/ DAD injection, as an internal standard (Campos & Markham, 2007). 6.1.3.1.3. HPLC/DAD analysis. For the HPLC/DAD pollen analysis several steps must be performed rigorously to have a correct identification of the compounds in the different samples with different origins: 1. HPLC/DAD system with a RP18 column; 2. Eluent formed by acidified water with ortho-phos- phoric acid to pH 2.4 (solvent A) and acetonitrile HPLC grade (solvent B), combined in a linear gradient according to the following: starting with 100% A, decreasing to 91% over the next 12min, to 87% over the next 8min, to 67% over the next 12min, to 57% over the next 10min, and holding that last proportion until the end of analysis (a total of 60min). Note: This gradient was optimized to avoid sample purification, which decrease time of preparation, sample manipulation and possible loose or degradation of com- pounds to be used on the fingerprints for each taxon. 40 M. G. Campos et al. Among phenolic and polyphenolic compounds many other polar constituents will be extracted with the hydroalcoholic solvent used; however, the contamin- ation does not interfere with the HPLC analyze because at the beginning a water gradient is used and the com- pounds that will be separated stay in the top (head) of the reverse phase column choose, allowing the more polar, i.e., amino acids, proteins, sugars, hydrosoluble vitamins and minerals to elute in the first minutes with- out interfering in the fingerprint. Phenolic and poly- phenolic compounds only start to be eluted 15min later with the increase of acetonitrile in the gradient; 3. Flow rate 0.8ml/min; 4. Temperature stated at 24 C; 5. Injection of the samples extracts (20 to 100 ml, depending on phenolic concentration); 6. Standard chromatograms plotted at wavelengths 260 and 340 nm (the choice of these two wavelengths con- sist in the knowledge that flavonols and flavones glyco- sides, the main compounds in pollens, have two characteristic bands of ultraviolet – absorption around these values; phenolic acids and its derivatives can also be identified using the same range); 7. Spectral data for all peaks is accumulated in the range 220–400 nm (the phenolic/flavonoid spectra are all in this display) using DAD; 8. Apparatus: HPLC system, Diode Array Detector with respective software; 9. The phenolic/polyphenolic profile of each sample is made up with all compounds resolved in its respective chromatogram; 10. The structural information for each compound is made by direct comparison of retention time and ultraviolet absorption spectra with standards, and according to the theoretical rules developed and compiled by Campos and Markham (2007). Note: the compounds can also be isolate and the structures determined by Nuclear Magnetic Resonance (NMR) and/or LC-MSMS (Campos et al., 1996, 1997). Briefly: The extracts are applying in sheets Whatman 3MM chromatography paper for 1D separation. Each compound is prepared for further studies by chroma- tography on a C-18 reversed phase column using water: acetonitrile gradient and checked for purity by HPLC/ DAD, according to Markham and Campos (1996). For the full structure elucidation by NMR spectra can be carry out in Bruker AC apparatus at 300MHz (or simi- lar) with the isolated compounds, solved in DMSO-d6, with TMS as intern standard at 30 C (Markham & Geiger, 1993). 6.2. Theoretical rules for structural determination of the main phenolic acids and flavonoids The identification of the compounds is carried out by direct comparison of retention time and ultraviolet absorption spectra (Campos & Markham, 2007). In Figure 33 flavonoid structures are shown to a better understanding of the explanation of the UV spectra related to the position of the substitution in the mol- ecule. The majority of the flavonoids in pollen are deriv- atives of flavones and/flavonols. The majority of the flavones found in pollens are apigenin or luteolin deriva- tives, and the compounds with a flavonol nucleus, are mainly kaempferol, quercetin or isorhamnetin. In the most samples these compounds appear as glycoside derivatives. Examples of different flavonol and flavone structures and its respective UV-spectra are show in Figure 34(a–g). Isoflavones, as daidzein, glycitein and genistein derivatives can also be found in certain pollens but are not so common. Examples, of rules developed in Campos and Markham (2007) for identification of details in the UV-spectra: 1. In all of them can be observed a clear existence of two intense bands of absorption which indicate the presence of the rings A, B and C from flavonoids. In Figure 34a are pointed the three important absorption points: a. Band I, usually with absorption around 340–390 nm. Flavones 340–350 nm; Flavonols-3-O- derivatized (Table 29) (as glycosides, for instance) Figure 32. Separation of bee pollen by color pellets from a sample that include different floral origin pollens. Figure 33. Basic flavonoid structure in order to show a better understanding of the explanation of the UV spectra related to the position of the substitution in the molecule (From Campos & Markham, 2007. Reproduced with permission). Standard methods for pollen research 41 350–360 nm; Flavonols with the C-3-O-H free 370–390 nm; b. Band II, usually with absorption around 240–280 nm; c. shoulder between 280 and 310 nm – substitution in C7; The absence of the shoulder between 280 and 310 nm is indicative of a substitution in C7-OH. Example, flavones as Apigenin (Figure 34a) and apigenin- 7-O-derivative (Figure 34b). This –OH is free in Apigenin itself with no substitution, and the shoulder remain in the UV-spectra. Figure 34. Examples of the more common UV- spectra found in bee pollens: (a) apigenin; (b) apigenin-7-O-derivative; (c) luteolin; (d) kaempferol-3-O-derivative; (e) quercitin-3-O-derivative; (f) isorhamnetin-3-O-derivative; (g) chalcone. 42 M. G. Campos et al. Example, flavonols as Kaempferol-3-O-derivatives (Figure 34d) and Kaempferol-3,7-O-di-derivatives (sub- stitution in C7-OH) (Figure 34e). The same absence of the shoulder at 280–310 nm can also be seen for Quercetin-3,7-O-di-derivative (Figure 34g). When the C7-OH is free the shoulder is present at 280–310 nm (a flat region in this part of the spectrum), examples of luteolin, Kaempferol-3-O-derivative and Quercetin-3-O- derivative (Figures 34c, d and f, respectively – all have the C7-OH free); 2. Differences between isorhamnetin and quercetin: Comparing isorhamnetin-3-O-and quercetin-3-O-deriva- tive, the difference in the structure is in B-ring with a methyl group in C3’ hydroxyl in the first. This implies an intensification of Band IIb and IIa (wavelengths of UV absorption for both around 255 and 265shoulder nm). Quercetin show a smoother absorption among these two bands; 3. To distinguish both structures, flavones or flavonol 3- O-substituted the relative intensity of absorption among Band I and Band II should be analyzed. If Band I is higher than Band II, usually are flavones but in the inverse case, Band I lower then Band II is a high prob- ability to be a flavonol-3-O-substituted (glycosylated in the majority of the times) (examples in Figure 34); Note: More details for UV interpretation of the spectra in Campos and Markham (2007). 4. In Tables 30 and 31, the wavelengths related to the oxygenation pattern, for the more common flavones and flavonols can be consulted and there, a prevision of the bathochromic effect (relating to a shift to a lon- ger wavelength in the absorption spectrum of a com- pound) in band I with the increase of the oxygenation pattern on B-ring in these structures. However, when these changes occur, usually the UV-absorption of Band II remain the same (Table 31). 6.3. Quantification of the major floral specie (floral source) in a mixture With this method it is also possible the identification of the major taxon source in mixtures of various floral spe- cies (different color loads/pellets in general correspond- ing to various floral sources), if one of them is in a high percentage. 1. Analyze the phenolic HPLC/DAD profiles (finger- prints) for the different taxon found in the mixture. 2. In each taxon select the compound that can be used as a marker for this specie. The compound used as marker should not be found in the other floral species in the full mixture. Note: This approach is supported by microscopic analysis. The flavonoid/phenolic HPLC/ DAD fingerprint of the full mixture should be the same as the profile corresponding to the major floral specie, i.e., if the major floral source in the bee pollen sample (batch) is Salix atrocinerea, the fingerprint match with the one obtained with same floral source in the data base made up with the hand/herbarium pollen sample. 3. To achieve the percentage of this major monofloral identification in a bee pollen mixture: a. Run HPL/DAD profile of the mixture and com- pare to the data base to verify if it is the same as one of them; b. Once the floral specie is identified choose one of the major compounds as a marker and its quanti- fication will correspond to 100%. Note: analyze the fingerprints obtained with the various pellets (other floral origins) in the mixture and choose a compound that does not belong to them; c. Quantify the same compound in the mix. The amount determined will be a % of the marker and corresponds to the percentage of the major specie in the entire batch. In Figure 35 an example involving a mixture of bee pollen with about 60% of Eucalyptus globulus is shown. In this case, quercetin-3-O-sophoroside (di-glycoside) was chosen for quantification and the calibration curve was made with rutin, which is a similar di- glycoside of quercetin as the one used as marker for this taxon. Note: The majority of the flavonoids in pollen are kaempferol, quercetin, isorhamnetin, apigenin or luteolin Table 29. Amplitude of the Wavelengths in Band I of flavones and flavonols UV spectra. Flavonoid type k (nm) Flavones 304–350 Flavonols (OH-3 derivative) 328–357 Flavonol (OH-3 free) 352–385 Table 31. Wavelengths of Band II in UV spectra of flavones with oxygenation only in A-ring. Flavone Oxygenation pattern of A-ring kmax. (nm) Flavone 250 5-hydroxiflavone 5 268 7-hydroxiflavone 7 252 5,7-di-hydroxiflavone 5.7 268 Baicalein 5,6,7 274 Norwogonin 5,7,8 281 Table 30. Wavelengths of Band I in UV spectra of flavonols with a different pattern of oxygenation in B-ring. Oxigenation pattern Flavonols Ring-A and C Ring-B kmax. (nm) Galangin 3,5,7 – 359 kampferol 3,5,7 40 367 Quercetin 3,5,7 30, 40 370 Myricetin 3,5,7 30, 40, 50 374 Standard methods for pollen research 43 derivatives, mainly glycosides. However, many different structures can be found and is not difficult found a good marker for each taxon. A combination of two or more markers can also be used if necessary. 7. Determination of phenolic profile of bee pollen extracts by LC and LC/MS Polyphenols are known to interact with compounds present in foods, like carbohydrates, proteins or lipids (Jakobek, 2015; Ozdal et al. 2013). Comprehensive analytical methods such as LC and LC/MS can be used to obtain more detailed information on phenolic profile of bee pollen as well as on interactions in food systems. Standard procedures for the extraction of phenolic compounds from bee pollen, pre-concentra- tion of phenolic extracts prior to analysis, LC and LC/MS techniques for their determination will be described. 7.1. Polyphenolics: importance, structure and classification The phenolic compounds in pollen grains are important as a part of reproductive process in plants. They pro- tect pollen load from destructive exterior factors such as UV-radiation (LeBlanc et al., 2009). During the ger- mination of pollen load, the formation of two protective membranes – exine and intine is occurred. Both mem- branes are rich in content of phenolics. Campos et al. (1997) have shown that it is possible to establish the correlation between the polyphenols and palynological origin of bee-collected pollen. There are thousands phenolic structures of substances present in plants (Boudet, 2007). It can be the simple molecular structure with one substituted benzenoic ring or complex polyphenolic structure with two or more inter- connected aromatic rings. Natural phenolic compounds can be classified according to their structure in two major classes: 1. non-flavonoids polyphenols (Lignans and lignins, phen- olic acids, coumarins, stilbene oligomers, gallotannins, ellagitannins and procyanidins (Soto-Vaca et al., 2012)) (Table 32); 2. flavonoids (large group of molecules with complex structure derived from p-coummaric acid. Basically, it consists of two aromatic rings with different alkyl and (or) O-substituents and with multiple chiral centers (Ya~nez et al., 2013). Benzene rings A and B are con- nected with C3 chain which are often closed and form heterocyclic ring C (Figure 36). There are a significant number of subclasses of fla- vonoids based on different reactions that occur on the rings over the lateral groups – hydroxylation, prenyla- tion, alkalinisation and glycosylation (Stalikas, 2007): chalcones (without formed C ring), aurones, flavanols (includes catechins, epicatechins and procyanidins), fla- vonols, flavones flavanones, isoflavones and antocya- nins. The general structures of these subclasses of flavonoids are presented in Table 33. Presence of sugar unit (in form of glycoside) and OH-groups increase water solubility of these molecules, meanwhile the presence of alkyl groups make them lipophilic. The most abundant form of flavonoids is the glycosidic form with different sugars linked (glucose, ramnose, etc.). If there is no bonded sugar unit, flavonoids are in aglycone form. 7.2. Preparation of pollen extracts for determination of phenolic compounds Bee pollen can be considered as a complex mixture of different compounds which differ, both, in chemical composition as well as in their solubility. The complex- ity of the structure of the pollen grains are also reflected in the fact that it is protected by two mem- branes with the main outer, exine, that consists of poly- mer sporopollenin. For this reason, isolation and extraction of material from pollen requires prior soften- ing or maceration of pollen grain so that membranes Figure 35. Fingerprint of Eucalyptus globulus obtained with a pollen pellet (100% pure) and a mixture of bee pollen with about 60% of Eucalyptus globulus pollen pellets. Figure 36. General formula of flavonoids. 44 M. G. Campos et al. Table 32. Model of chemical structures of subclasses or representative molecule of subclasses of non-flavonoids phen- olic compounds. Subclass Model of chemical structure or model of representative molecule Name Lignans virolin Lignins pinoresinol Phenolic acids hydroxycinnamic acids hydroxybenzoic acids Coumarins coumarin Stilbenes resveratrol Tannins gallotannin Standard methods for pollen research 45 slightly relaxed or their physical disruption (by using ultrasound or sonification) in order to increase the extraction efficiency. Application of ultrasound (which increases penetration of solvent’s molecules into the pollen matrix thereby enhance contact of solvent and the respective soluble components therein) is especially recommended due to the presence of thermolabile components in plant materials (Wang & Weller, 2006), including pollen. Generally, during the entire extraction process application of higher temperature should be avoided in order to preserve the original compos- ition of the compounds present in the pollen Table 33. Model of chemical structures of flavonoids. Subclass Model of chemical structure Chalcones Aurones Flavanols Flavonols Flavones Flavanones (Continued) 46 M. G. Campos et al. because some of them are volatile at elevated tem- peratures (lipids, phenolic compounds, etc.) or they can lose their native structure (free amino acids, proteins, polysaccharides). All phenolic compounds present in plants can be regarded as more or less water soluble (flavonoids, most of the phenolic acids, gallotannins and ellagitannins) and water insoluble (coumarine, stilbenes, proantocyanidins, some phen- olic acids bonding in the cell wall, lignins). Solubility/ Insolubility in water and similar solvents depends pri- mary on the presence of side groups attached to the aromatic rings. 7.2.1. Extraction of phenolic compounds from pollen – gen- eral procedure Based on the aforementioned the following procedure for the extraction of phenolic compounds from pollen can be proposed: 1. Measure the appropriate mass of pollen sample (e.g., 0.5 g); 2. Add 20 cm3 (calculated for 0.5 g of pollen) of heptane in order to remove lipid components; 3. Shake thoroughly sample on Vortex and place it in an ultrasound bath for 15min at 30 C; 4. Centrifuge sample (5000 rpm) to separate non-polar, lipid fraction; 5. Add 20 cm3 (calculated for 0.5 g of pollen) of 50% ethanol on the residual undissolved portion of pollen and place it in an ultrasound bath for 15min at 30 C; 6. Centrifuge sample (5000 rpm) in order to separate liquid and solid phases; 7. Evaporate ethanol from supernatant by vacuum-rotary evaporator at temperature of 35 C; 8. Add ethyl acetate to the remaining aqueous solu- tion (volumes of solution and extraction solvent should be equal) in order to perform the extrac- tion of the phenolic compounds and their separ- ation from the remaining organic substances (proteins and sugars); A phenolic fraction, obtained in this way, is prepared for further concentration using the solid-phase extrac- tion (SPE) method. 7.2.2. Preparation of enzymatic hydrolysates from pollen Besides the common extracts for determination of phenolic profile of pollen, some authors (Rzepecka- Stojko, Pilawa et al., 2012; Rzepecka-Stojko, Stec et al., 2012) have prepared two types of enzymatic hydroly- sates from pollen: pepsin hydrolysates from pollen (PEP) and ethanol extracts of pepsin-digested bee pollen (EEPP). On the other hand, Smirnova et al. (2012) pre- pared enzymatic hydrolysate of pollen’s exine by using feruloyl esterase. 7.2.2.1. Preparation of PEP. 1. Measure 20 g of pollen samples. 2. Add distilled water (volume of distilled water should be five times the volume of sample) and acidify with conc. HCl until reach pH 2. 3. Add pepsin to obtain its concentration of 1%. 4. Incubate sample at 37 C for 48 h to per- form hydrolysis. 5. Boil sample for 10min to stop enzymatic activity. 6. Filter the obtained enzymatic hydrolysate under reduced pressure. 7. Centrifuge the filtrate for 10min at 10,000 rpm. 8. Evaporate the supernatant at rotary vacuum-evapor- ator to yield dry extract. Table 33. (Continued). Subclass Model of chemical structure Isoflavones Antocyanins Standard methods for pollen research 47 T ab le 34 . So m e pu bl ic at io ns on LC an d LC /M S an al ys is of po ly ph en ol ic co m po un ds fr om be e po lle n sa m pl es . C om po un ds M et ho d St at io na ry ph as e M ob ile ph as e t ( C ) Fl ow ra te (m L/ m in ) k (n m ) R ef er en ce s A B F la vo no id s H PL C -P A D C 18 1 1. 9 cm 0. 4 cm , 5 mm O rt ho ph os ph or ic ac id pH 2. 5 A ce to ni tr ile 24 0. 8 22 0- 40 0 C am po s et al .( 19 97 ) F la vo no id s (a gl yc o ns ) H PL C -D A D C 18 4 .6 m m 25 0 m m , 10 mm O rt ho ph os ph or ic ac id pH 2. 6 M et ha no l 2 27 8- 28 2 27 8- 35 0 Se rr a- Bo nv eh  ı et al .( 20 01 ) P he no lic ac id s, fla vo no id s N an o- LC -U V C 18 1 00 mm I.D . 10 cm 0. 5% fo rm ic ac id M et ha no l 50 0 nl /m in 20 0, 28 0 Fa na li et al .( 20 13 ) A nt ho cy an in s H PL C -D A D -E SI -M S/ M S C 18 1 50 m m 4. 6 m m , 5 mm 0. 1% tr ifl uo ra ce tic ac id A ce to ni tr ile 35 0. 5 52 0 D iP ao la -N ar an jo et al .( 20 04 ) F la vo no id s H PL C -P A D -E SI -M S/ M S C 18 2 50 m m 4 m m , 5 mm 1% fo rm ic ac id M et ha no l 1 35 0, 52 0 Fe rr er es et al .( 20 10 ) F la vo no id s, hy dr o xy ci nn am ic ac id am id e de ri va ti ve s H PL C -P A D -E SI -M S/ M S C 18 2 50 m m 4. 6 m m , 5 mm 0. 1% ac et ic ac id M et ha no l 28 0. 5 27 0, 35 0 N eg ri et al .( 20 11 ) F la vo no id ag ly co ne s H PL C -D A D -A PC I/M S C 8 1 50 m m 4. 6 m m , 5 mm 0. 1% fo rm ic ac id in 5% ac et on itr ile A ce to ni tr ile 30 1 25 8 Lv et al .( 20 15 ) 48 M. G. Campos et al. 9. Complete drying in a laboratory incubator (desicca- tor) at 38 C. 10. Measure the dry extract and dissolve it in distilled water to prepare PEP-solution with concentration of 2mg/cm3. 7.2.2.2. Preparation of EEPP. 1. Extract the supernatant obtained after pepsin-treat- ment of pollen with 200 cm3 of 50% ethanol for 60min at room temperature with intensive shaking. 2. Filter the extract under reduced pressure. 3. Centrifuge the filtrate for 10min at 10,000 rpm. 4. Evaporate the supernatant at rotary vacuum-evapor- ator to yield dry extract. 5. Complete drying in a laboratory incubator (desiccator) at 38 C. 6. Measure the dry extract and dissolve in 50% ethanol solution to prepare EEPP-solution with concentration of 2mg/cm3. 7.2.2.3. Preparation of feruloyl esterase hydrolysate from pollen’s exine. For the preparation of this type of hydrolysate, Smirnova et al. (2012) used enzyme feruloyl esterase derived from the mold of genus Aspergillus sp. according to the following procedure: 1. Incubate the exine of pollen in acetate buffer solution pH 4.5 containing enzyme feruloyl esterase in quantity of 5 g/dm3 for 24 h at 50 C; 2. Thoroughly wash the digested material with dis- tilled water; 3. Incubate in 1% sodium-dodecylsulfate (SDS) solution; Table 35. Mass spectral data of compounds detected in extracts of bee pollen. No [MþH]þ, m/z [M-H]-, m/z MS/MS positive ion mode MS/MS negative ion mode Proposed identification References 1 685.0 Rosmarinic acid dihexoside derivative Negri et al. (2011) 2 627.2 481.0, 319.0 Myricetin-3-O-rhamnosyl-glucoside Negri et al. (2011) 3 435.0 303.0 Quercetin-3-O-arabinoside Negri et al. (2011) 4 641.2 479.0, 317.0 Isorhamnetin-3-O-diglucoside Negri et al. (2011) 5 595.0 449.0, 287.0 Kaempferol-3-O- rhamnosyl-glucoside Negri et al. (2011) 6 771.2 625.1, 479.1, 317.1 Isorhamnetin-3-O- (20 ',30’-dirhamnosyl)glucoside Negri et al. (2011) 7 611.1 303.1 Rutin Negri et al. (2011) 8 625.2 479.0, 317.0 Isorhamnetin-3-O- rhamnosyl-glucoside Negri et al. (2011) 9 449.0 287.0 Kaempferol-3-O-glucoside Negri et al. (2011) 10 641.2 495.0, 333.0 Patuletin-3-O- rhamnosylglucoside Negri et al. (2011) 11 449.2 303.1 (100%) Quercitrin Negri et al. (2011) 12 381.4 261.0, 235.2, 147.2 Chalcone Negri et al. (2011) 13 761.3 615.3, 381.1, 287.0 Kaempferol-7-O-rhamnosyl-3-O-galloyl glucuronide Negri et al. (2011) 14 584.3 438.2, 420.2 N’ ,N’’ ,N’’’-tris-p-coumaroylspermidine Negri et al. (2011) 15 674.3 498.2 , 480.3 N’ ,N’’ ,N’’’-tris-p-feruloylspermidine Negri et al. (2011) 16 465 303 Delphinidin-3-O-glucoside Di Paola-Naranjo et al. (2004) 17 611 303, 465 Delphinidin-3-O-rutinoside Di Paola-Naranjo et al. (2004) 18 449 287 Cyanidin-3-O-glucoside Di Paola-Naranjo et al. (2004) 19 595 287, 449 Cyanidin-3-O-rutinoside Di Paola-Naranjo et al. (2004) 20 479 317 Petunidin-3-O-glucoside Di Paola-Naranjo et al. (2004) 21 625 317, 479 Petunidin-3-O-rutinoside Di Paola-Naranjo et al. (2004) 22 609 301, 463 Peonidin-3-O-rutinoside Di Paola-Naranjo et al. (2004) 23 639 331, 493 Malvidin-3-O-rutinoside Di Paola-Naranjo et al. (2004) 24 535 287, 449 Cyanidin-3-(60’-malonylglucoside) Di Paola-Naranjo et al. (2004) 25 625 463, 445, 300 Quercetin-3- sophoroside Ferreres et al. (2010) 26 623 315 Isorhamnerin-3- rutinoside Ferreres et al. (2010) 27 609 463, 445, 300 Quercetin-3- neohesperidoside Ferreres et al. (2010) 28 609 447, 429, 285 Kaempferol-3- sophoroside Ferreres et al. (2010) 29 739 593, 575, 284 Kaempferol-3-(4- rhamnosyl)- neohesperidoside Ferreres et al. (2010) 30 593 447, 429, 284 Kaempferol- 3- neohesperidoside Ferreres et al. (2010) 31 635 593, 489, 471, 284 Kaempferol-3-(acetyl)- neohesperidoside Ferreres et al. (2010) 32 739 593, 285 Kaempferol-3- neohesperidosyl- 7- rhamnoside Ferreres et al. (2010) 33 447 285 Kaempferol-3- glucoside Ferreres et al. (2010) 34 593 285 Kaempferol-3- rutinoside Ferreres et al. (2010) 35 635 593, 489, 471, 284 Kaempferol- 3- (acetyl)- neohesperidoside isomer Ferreres et al. (2010) Standard methods for pollen research 49 4. Wash again with distilled water; 5. Dry at 55 C until constant mass has been reached. 7.2.3. Application of SPE for pre-concentration of phenolic compounds for further LC and LC/MS determination Solid-phase extraction (Figure 37) is one of the methods of sample preparation for the further analysis. It was developed during the 1980s. Currently, SPE is applied for pre-concentration of samples or for their isolation and purification (Bertoncelj et al., 2011; Gasic et al., 2014a; 2014b; Keckes et al., 2013; Santana et al., 2009). It is based on interaction of some components from liquid phase with solid (sorbent) phase. The desired compound retains on column, meanwhile, all the unwanted components have been washed and removed with rinsing of column in convenient medium. The ana- lyte is than recovered with small quantity of appropriate solvent. In this way, apart from the isolation of the sub- stance, its pre-concentration is achieved which facilitate Table 36. Primer Sequences with indexes SA501 – SB712 (adapted from Kozich et al., 2013). Forward Name Sequence SA501 AATGATACGGCGACCACCGAGATCTACAC ATCGTACG CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA502 AATGATACGGCGACCACCGAGATCTACAC ACTATCTG CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA503 AATGATACGGCGACCACCGAGATCTACAC TAGCGAGT CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA504 AATGATACGGCGACCACCGAGATCTACAC CTGCGTGT CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA505 AATGATACGGCGACCACCGAGATCTACAC TCATCGAG CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA506 AATGATACGGCGACCACCGAGATCTACAC CGTGAGTG CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA507 AATGATACGGCGACCACCGAGATCTACAC GGATATCT CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SA508 AATGATACGGCGACCACCGAGATCTACAC GACACCGT CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB501 AATGATACGGCGACCACCGAGATCTACAC CTACTATA CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB502 AATGATACGGCGACCACCGAGATCTACAC CGTTACTA CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB503 AATGATACGGCGACCACCGAGATCTACAC AGAGTCAC CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB504 AATGATACGGCGACCACCGAGATCTACAC TACGAGAC CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB505 AATGATACGGCGACCACCGAGATCTACAC ACGTCTCG CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB506 AATGATACGGCGACCACCGAGATCTACAC TCGACGAG CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB507 AATGATACGGCGACCACCGAGATCTACAC GATCGTGT CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT SB508 AATGATACGGCGACCACCGAGATCTACAC GTCAGATA CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT Reverse Name Sequence SA701 CAAGCAGAAGACGGCATACGAGAT AACTCTCG AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA702 CAAGCAGAAGACGGCATACGAGAT ACTATGTC AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA703 CAAGCAGAAGACGGCATACGAGAT AGTAGCGT AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA704 CAAGCAGAAGACGGCATACGAGAT CAGTGAGT AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA705 CAAGCAGAAGACGGCATACGAGAT CGTACTCA AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA706 CAAGCAGAAGACGGCATACGAGAT CTACGCAG AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA707 CAAGCAGAAGACGGCATACGAGAT GGAGACTA AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA708 CAAGCAGAAGACGGCATACGAGAT GTCGCTCG AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA709 CAAGCAGAAGACGGCATACGAGAT GTCGTAGT AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA710 CAAGCAGAAGACGGCATACGAGAT TAGCAGAC AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA711 CAAGCAGAAGACGGCATACGAGAT TCATAGAC AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SA712 CAAGCAGAAGACGGCATACGAGAT TCGCTATA AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB701 CAAGCAGAAGACGGCATACGAGAT AAGTCGAG AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB702 CAAGCAGAAGACGGCATACGAGAT ATACTTCG AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB703 CAAGCAGAAGACGGCATACGAGAT AGCTGCTA AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB704 CAAGCAGAAGACGGCATACGAGAT CATAGAGA AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB705 CAAGCAGAAGACGGCATACGAGAT CGTAGATC AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB706 CAAGCAGAAGACGGCATACGAGAT CTCGTTAC AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB707 CAAGCAGAAGACGGCATACGAGAT GCGCACGT AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB708 CAAGCAGAAGACGGCATACGAGAT GGTACTAT AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB709 CAAGCAGAAGACGGCATACGAGAT GTATACGC AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB710 CAAGCAGAAGACGGCATACGAGAT TACGAGCA AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB711 CAAGCAGAAGACGGCATACGAGAT TCAGCGTT AGTCAGTCAG CC TCCTCCGCTTATTGATATGC SB712 CAAGCAGAAGACGGCATACGAGAT TCGCTACG AGTCAGTCAG CC TCCTCCGCTTATTGATATGC Index and Read Name Sequence Read1 CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT Read2 AGTCAGTCAG CC TCCTCCGCTTATTGATATGC Index GCATATCAATAAGCGGAGGA GG CTGACTGACT Index sequences indicated in bold. 50 M. G. Campos et al. further analysis. Also, the use of large amounts of organic solvents for extraction can be avoided (Rouessac & Rouessac, 2007). This is important due to three reasons – medical, environmental and economic. Typical solid phase extraction involves several steps (Rouessac & Rouessac, 2007) (Figure 37): 1. activation and rinsing of the sorbent before using it – performed by passing a certain volume of solvent simi- lar polarity as well as samples that will be loaded to the cartridge; 2. adsorption of the analyte by loading of known volume of sample; 3. elimination of all interfering compounds by rinsing cartridge with adequate solvent; 4. desorption of an analyte by percolation of cartridge. The solid phase in cartridge is made of similar mate- rials like solid phase in LC-columns depending of type of analyte. A number of sorbents may be used such as silica gel, cellulose, aluminum oxide, polyamide and bonded silica gels (Milojkovic-Opsenica et al., 2015). Polar compounds are isolated from cartridge with non- polar matrix. If the analyzed sample contains non-polar components, they can be isolated from cartridge with polar matrix made of C-18 derivatized silica gel. This gel has attached a hydrocarbonic C18-chain which increases its hydrophobicity. They were the first type of sorbents applied for SPE pre-concentration of phenolic compounds from water samples (Mußmann et al., 1994; Rodrıguez et al., 2000; Tian et al., 2005). Interactions between phenolic compounds and this type of sorbent, based on Van der Waal’s forces, can be weak if phenols are in ionized states, so it is necessary to adjust the pH at the proper value. Also, since silica materials are sen- sitive on pH value, it is possible to substitute this type of sorbent with some other, more polar matrices such as modified polystyrene-divinylbenzene polymeric (XAD) resins (Fontanals et al., 2007; Li et al., 2002; Wissiak & Rosenberg, 2002). The procedure is similar to those applied for C-18 derivatized silica gel but adsorption area is larger and presence of some aro- matic parts in polymeric structure made it more suit- able for phenols extraction (Santana et al., 2009). A typical cartridge SPE manifold can accommodate up to 24 cartridges. Most SPE manifolds are equipped with exit for connection to vacuum or water pump. Application of reduced pressure speeds up the extrac- tion process by pulling the liquid sample through the stationary phase. The analytes are collected in sample tubes inside or below the manifold after they pass through the stationary phase. Before the loading on the cartridge samples are usually passed through a disk for extraction 0.5mm thickness and 25 to 90mm in diam- eter (Rouessac & Rouessac, 2007). It serves to remove the low quantity of organic substances which are pos- sibly present in the tested aqueous solution. Table 37. International data on the protein content (% D.M) of bee pollen. Crude protein content (% D.M) Type of samples Number of samples Values References Multifloral 21 21.0–29.3 Herbert & Shimanuki, 1978 Multifloral 20 12.6–18.2 Serra-Bonvehı & Escola Jorda, 1997 Monofloral 194 9.2–37.4 Somerville, 2001 Multifloral 15 9.8–16.5 Villanueva et al., 2002 Monofloral 29 13.6–31.9 Andrada & Telleria, 2005 Multifloral 10 21 ± 4 Almeida-Muradian et al., 2005 Multifloral 6 batches 23.59 Melo et al., 2005 Monofloral 123 13.0–24.5 Szcze^sna, 2006a Multifloral (Poland) 13 15.8–24.1 Szcze^sna, 2006b Multifloral (Korea) 9 17.6–24.5 Szcze^sna, 2006b Multifloral (China) 5 17.8–26.1 Szcze^sna, 2006b Monofloral 42 6.3–26.3 Forcone et al., 2011 Multifloral 154 12.2–27.0 Martins et al., 2011 Multifloral 14 18.4–22.4 Balkanska & Ignatova, 2012 Multifloral 7 15.2–28.5 Stanciu et al., 2012 Monofloral 12 14.2–28.9 Yang et al., 2014 Multifloral 7 batches 23.38 ± 1.24 (Arruda et al., 2013) Multifloral 106 13.65–26.5 (Liolios et al., 2014) Monofloral 58 9.7–30.11 (Liolios et al., 2014) Average and standard deviation.Average. Figure 37. Solid phase extraction. Standard methods for pollen research 51 7.2.3.1. Application of SPE for pre-concentration of phenolic compounds from pollen. The literature for pre-concentration of phenolic compounds from pollen by SPE is very limited (Di Paola-Naranjo et al., 2004). According to our laboratory practice and experience the following procedure for pre-concentration of phen- olic compounds from pollen phenolic fraction prepared by general procedure can be proposed: 1. Condition and activate the SPE cartridge by passing 10 cm3 of methanol and 10 cm3 of 0.5% hydrochloric acid, successively. Do not allow air to enter the cart- ridge packing; 2. Load 2 cm3 of pollen phenolic fraction by passing slowly (no faster than one drop per second) into the cartridge. Do not allow air to enter in to the resin bed. Collect all cartridge effluent in clean tubes; 3. Wash the cartridge by passing 10 cm3 of 0.5% HCl (for purpose of elimination of potentially present sug- ars or some other polar substances). Collect all cart- ridge effluent in clean tubes; 4. Eluate the phenolic compounds by slowly passing (less than one drop per sec) of 5 cm3 of acidic solution of methanol (add 0.5% HCl). Do not allow air to enter into the resin bed. Collect phenolic solution in clean tubes; 5. Tap tubes and pack it into the refrigerator or freezer until further analysis. 7.3. LC and LC/MS techniques 7.3.1. LC techniques High-performance liquid chromatography or high-pres- sure liquid chromatography (HPLC) is highly improved form of column chromatography. It is based on the principle of forcing solvent through column, packed with stationary phase consisting of small particles, under high pressures (up to 400 atmospheres). Nano-liquid chromatography method with UV-Vis detection is also developed for analysis of phenolic compounds in bee pollen (Fanali et al., 2013). The main advantages of this method are short analysis time and reduced costs due to the small dimensions of the column. 7.3.1.1. LC-DAD technique. The photodiode array detector has been extensively used for the detection of polyphenolics due to their absorption in the UV region (Robards & Antolovich, 1997). Detection is based on the absorptive measurement at characteristic wave- lengths. Phenolic acids are usually detected at wave- lengths between 210 and 320 nm, anthocyanidins and anthocyanins (glycosides or acylglycosides of anthocyani- dins) between 500 and 530 nm, flavanols between 210 or 280 nm, flavanones at 280 nm, and possibly at 252, 285, 290 and 365 nm, flavones at 360 or 370 nm, flavo- nols and their glycosides at 270, 365, and 370 nm and isoflavones at 260 nm, and possibly between 230 and 280 nm. UV spectra of flavonoids, for example, have two absorption bands. Band I, with maximum absorp- tion in the range of 300 to 550 nm, arises from the A aromatic ring and band II, with maximum absorption in the range of 240 to 285 nm, comes from the B ring. In LC-DAD system, polyphenolic standards are used to generate characteristic UV-Vis spectra and retention times. Identification of individual polyphenolic com- pounds is achieved by comparison with retention times and UV-Vis spectra of standards. Quantification of these compounds is performed from the peak areas by com- parison to calibration curves obtained with standard sol- utions. As general procedure for determination of polyphenolic compounds from bee pollen extracts can be HPLC-DAD method developed by Campos et al. (1997). 7.3.1.2. LC-MS, MS/MS techniques. Although HPLC- DAD method is the reference method for the analysis of phenolic compounds, certain problems, like co-elu- tion and similar UV-Vis spectra of many compounds, can occur. As well, most glycosides and acyl residues are poor chromophores, so no further distinguishing can be achieved by means of DAD UV detection. In that case mass spectrometry (MS), more precisely, tan- dem mass spectrometry (MS/MS) detection is suggested for further characterization and identification of eluted compounds. The MS principle consists in ionizing chemical com- pounds to generate charged molecules or molecule fragments and measuring their mass-to-charge ratios (Sparkman, 2000). LC-MS provides structural informa- tion about eluted compounds but is rarely used for full structure characterization. Using LC-MS/MS more frag- mentation of the precursor and product ions is formed, providing additional structural information for the iden- tification of phenolic compounds like details about the aglycone moiety, the types of carbohydrates (mono-, di- , tri- or tetrasaccharides and hexoses, deoxyhexoses or pentoses) or other substituents present, interglycosidic linkages, attachment points of the substituents to the aglycone, etc. Aforementioned useful structural informa- tion could be obtained directly and easily applying elec- trospray ionization (ESI) and atmospheric pressure chemical ionization (APCI) techniques, and so, many purification procedures can be circumvented. Both are the soft ionization techniques and the most widely used in analysis of polyphenolic compounds in bee pollen and other food. ESI is gentler method and is generally used for polar compounds that can be ionized in solution, while APCI is used for less polar molecules that can undergo acid-based reactions in the gas phase (Biesaga & Pyrzynska, 2009). Both positive and negative ioniza- tion are applied. Negative ion mode provides the high- est sensitivity in flavonoid analysis and fragmentation is limited (Cuyckens & Claeys, 2002; de Rijke et al., 2003; Fabre et al., 2001; Wang et al., 2007), while mass 52 M. G. Campos et al. spectrum in the positive ion mode shows different frag- mentation pattern. Analyte responses can vary consider- ably so combined use of both EI and PI modes can prove complementary information’s which are helpful in the structure determination, especially for the minor compounds (Cuyckens & Claeys, 2004; de Rijke et al., 2006). The eluent system also has a distinct influence on the ionization efficiency and therefore on structural information. The most common additives are formic acid, trifluoroacetic acid, ammonium acetate and ammo- nium formate. They are volatile and thus compatible with LC-MS. Combination of methanol-ammonium for- mate at pH 4 gives the highest response in negative mode APCI (de Rijke et al., 2003), while the best sensi- tivity in ESI is achieved with acidic ammonium acetate buffer and organic component consisted of methanol and acetonitrile as mobile phase (Rauha et al., 2001). Formic acid has slight negative effects on the ionization efficiency but improves chromatographic separation and peak shapes (Prokudina et al., 2012). For trifluoroacetic acid is reported that suppresses the ionization due to ion-pairing and surface-tension effects (Costa et al., 2000). Chromatographic retention times provide useful structural information. In reversed-phase HPLC separ- ation of polyphenolics on the basis of their polarity, the elution order of polyphenolics may be predicted Glycosylation increases polarity of flavonoids and there- fore their mobility in the reversed-phase system. Acylation and methylation have the opposite effect but their position have significant influence on the retention time (Greenham et al., 1995; Harborne & Boardley, 1984). In case of flavonoid glycosides rutinosides pre- cede neohesperidosides, galactosides precede glucosides (Robards & Antolovich, 1997), glucosides precede arabi- nosides and arabinosides precede rhamnosides (Harborne & Boardley, 1984; Schieber et al., 2002). Linkage position can have an influence on the retention, too. The elution order for different classes of flavonoids is flavanones, flavonols and flavones, for compounds with equivalent substitution pattern. The elution order for hydroxycinnamic acids is caffeic acid, p-coumaric acid, sinapic acid, ferulic acid and cinnamic acid while for benzoic acids order is gallic acid, protocatechuic acid, vanillic acid and syringic acid (Rodrıguez-Delgado et al., 2001). Quality and reliability of analysis depend on the com- bination of the mass analyzer with the detector. Analyzers can belong to magnetic sector, time-of-flight (TOF) or Fourier transform (FT) generic type, depend- ing on the physics of mass analysis. There are analyzers that can perform MS and MS/MS (MS2) analysis, some- times to a high MSn stage or different analyzers could be combined together into one hybrid instrument. Mass analyzers used for analyzing polyphenolic compounds are usually quadrupole and ion-trap instruments. Ion- trap instruments can perform MSn experiments and that is its main advantage (de Rijke et al., 2003). Using ion- trap mass spectrometry Ferreres et al. (2010) reported the presence of non-colored flavonoids in bee pollen from Echium plantagineum and Lv et al. (2015) identified and quantified flavonoid aglycones in rape bee pollen collected from Qinghai-Tibetan Plateau. In order to optimize signals and to obtain maximal structural infor- mation from ion of interest, the different collision energy values should be applied. Methods based on low-energy collision induced dissociation permit the characterization of most structural features of flavonoid glycosides. High-energy CID methods provide additional structural information through more fragmentation processes. Collision energy directly affects abundance ratio of the various fragment ions. Optimum CE varies for different compounds. Gu et al. (2012) showed that a CE of 70 eV is sufficient to cause abundant product ions for structural elucidation of flavonoids and 30 eV for generation characteristic fragment ions for chloro- genic acid (Gu et al., 2012). Recent publications on LC and LC/MS analysis of polyphenolic compounds from bee pollen samples are listed in Table 34. In the past, fragmentation behavior of phenolic com- pounds, especially flavonoids, have been extensively investigated. A great number of rules for structural characterization of unknown compounds, even without the reference standards, were summarized (de Rijke et al., 2006). As experience shows, fragmentation path- ways are largely independent of the ionization mode (ESI or APCI) and the type of instrument (triple quadru- pole or ion trap) used (de Rijke et al., 2003; Rauha et al., 2001) so that rules can be applied for resolving spectral data obtained with modern instruments. Characteristic m/z values of fragment ions from mass spectral data used for identification of certain poly- phenolic compounds from bee pollen are listed in Table 35. 7.3.2. UHPLC-HESI-MS/MS technique for determination of phenolic compounds The LTQ-Orbitrap spectrometer supports a wide range of applications. Its MS/MS capabilities make this mass spectrometer extremely powerful, among other things, for unambiguous detection of polyphenolic compounds (Keckes et al., 2013; Natic et al., 2015; Pantelic et al., 2014; Ristivojevic et al., 2014). Some chromatograms and mass spectra from our previous research are shown on Figures 38–40. Instrumentation and Table 38. Determination of the protein content (%) using dif- ferent volumes of the H3BO3 solution. Volume of H3BO3 (ml) Protein content (%) n¼ 5 30 20.49 (± 0.07)a 40 20.44 (± 0.06)a Analysis performed under the same conditions except the volume of the H3BO3 solution used. Standard methods for pollen research 53 conditions for determination of phenolic compounds using this method are as follows: 1. Pollen extracts (Section 7.2); 2. Thermo Scientific liquid chromatography system equipped with: a. Quaternary Accela 600 pump; b. Accela Autosampler; c. Linear ion trap-Orbitrap hybrid mass spectrom- eter (LTQ OrbiTrap XL, Thermo Fisher Scientific, Bremen, Germany) with heated electro- spray ionization (HESI); d. Hypersil gold C18 column (50 2.1mm, 1.9 mm) from Fisher Scientific. 3. Mobile phases: a. water þ 0.1% formic acid; b. acetonitrile þ 0.1% formic acid. 4. Linear gradient: 0–5min from 5% to 95% (B), 5–6min 95% (B) then 5% (B) for 3min; a. HESI-source parameters: b. Source voltage 4 kV; c. Capillary voltage 47 V; d. Tube lens voltage 159.11 V; e. Capillary temperature 275 C; f. Sheath and auxiliary gas flow (N2) 25 and 8 (arbi- trary units); g. 100–1500 m/z; h. Collision energy 35 eV. 5. Injection volume 5 ml; 6. Flow rate of 0.400ml/min. 8. Standard method for identification of bee pollen mixtures through meta-barcoding Pollen analysis is a central part of bee ecology research (Carvell et al., 2006; Danner et al., 2014; K€oppler et al., 2007). Identification of plant species origin of bee col- lected pollen traditionally relies on light microscopy and discrimination based on morphological differences of pollen grains (Mullins & Emberlin, 1997). This is labor- and time-intensive (Galimberti et al., 2014), requires expert knowledge (Keller et al., 2015) and lacks dis- criminative power at lower taxonomic levels (Galimberti et al., 2014; Williams & Kremen, 2007), which means that pollen from closely related plant spe- cies often has to be analyzed at the family or genus level. Recently, meta-barcoding has emerged as a suit- able alternative for pollen analysis (Keller et al., 2015; Kraaijeveld et al., 2015; Richardson et al., 2015; Valentini et al., 2010). However, due to a missing con- sensus on the best marker for plant species identifica- tion and the variety of DNA sequencing platforms available, different methods and protocols exist (e.g., Bruni et al., 2015; Galimberti et al., 2014; Keller et al., 2015; Kraaijeveld et al., 2015; Richardson et al., 2015), which makes it difficult to compare independent studies. We here present a detailed protocol of the method described recently (Sickel et al., 2015) as a research standard that is highly cost-efficient and overcomes those limitations. It is based on ITS2-meta-barcoding, which has been validated for plant barcoding (Chen et al., 2010) and for which a comprehensive database has been established (Ankenbrand, 2015). A variant of this method has been recently developed also for the rbcl gene, and analyzing both markers in parallel with this workflow is recommended for most applications (Bell et al., 2019). Beside the laboratory process, we also provide information on data processing and analysis. 8.1. Meta-barcoding protocol 8.1.1. Required materials 8.1.1.1. Reagents. DNA isolation kit suitable for pollen grains (e.g., Macherey-Nagel NucleoSpin Food, D€uren, Germany); PCR grade water; Ethanol (96–100%); Primers as given in Table 1; Polymerase with proof- reading ability including dNTPs, GC buffer and co-fac- tors (e.g., 2 Phusion Master Mix); Agarose, suitable buffer (e.g., TAE), intercalating dye (e.g., Midori Green Advance, Biozym Scientific GmbH, Hessisch Oldendorg, Germany), 6 loading dye, DNA ladder (e.g., FastRuler Low Range DNA Ladder, Life Technologies, Carlsbad, CA, USA); SequalPrepTM Normalisation Kit 96 wells (Invitrogen, Carlsbad, CA, USA); Bioanalyzer High Sensitivity DNA Chip (Agilent Technologies, Santa Clara, CA, USA); dsDNA High Sensitivity Assay (Life Technologies, Carlsbad, CA, USA); MiSeq Reagent Kit v2 2 250 bp (Illumina Inc., San Diego, CA, USA); 1N NaOH (stock solution); PhiX Sequencing Control v3 (Illumina Inc., San Diego, CA, USA) 8.1.1.2. Laboratory equipment. Microliter pipettes and tips; Microcentrifuge tubes; Electronic pestle; Bead mill; Incubator; Vortexer; Table centrifuge; 96 well PCR plates and PCR foils; 96 well plate cooling block; 96 well plate centrifuge; Thermal cycler; Agarose gel for- mer; microwave, gel electrophoresis chamber; UV illu- minator; Bioanalyzer, chip vortexer; Qubit Fluorometer; Access to an Illumina MiSeq desktop sequencer with MiSeq Control Software version 2.2 or later. 8.1.2. Pollen acquisition Pollen sampling should be performed as described in the pollination chapter of the COLOSS BEEBOOK Vol. 1, chapters 3.1. and 4.1.1 (Delaplane et al., 2013). For long-term storage, we recommend lyophilization before freezing at 80 C. 8.1.3. Laboratory workflow 8.1.3.1. DNA extraction. For the DNA extraction step, we recommend using the Macherey-Nagel (D€uren, Germany) NucleoSpin Food Kit and following the sup- plementary guidelines for pollen samples, but equivalent 54 M. G. Campos et al. extraction procedures may also be comparable. The DNA extraction steps are as follows: 1. Take 2 g of pollen and add 4ml bidest H2O; 2. Homogenize the sample with an electronic pestle; 3. Take 200 ml ( 50mg pollen) of the emulsion and grind it in a bead mill; 4. Add 400 ml Buffer CF (preheated to 65 C) and 10 ml Proteinase K and mix carefully; 5. Incubate at 65 C for 30min; 6. Centrifuge the mixture for 10min (>10,000 g); 7. Transfer the supernatant into a new microcentrifuge tube and add 1 vol Buffer C4 and 1 vol ethanol; 8. Vortex for 30 s; 9. Pipette 700 ml mixture onto a NucleoSpin Food Column placed in a Collection Tube; 10. Centrifuge for 1min at 11,000 g; 11. Discard the flow-through; 12. Repeat steps 9-1; 13. Add 400 ml Buffer CQW onto the spin column; 14. Centrifuge for 1min at 11,000 g; 15. Discard the flow-through; 16. Add 700 ml Buffer C5 onto the spin column; 17. Centrifuge for 1min at 11,000 g. 18. Discard the flow-through; 19. Add 200 ml Buffer C5 onto the spin column; 20. Centrifuge for 2min at 11,000 g; 21. Place the spin column into a new 1.5ml microcentri- fuge tube; 22. Add 100 ml Elution Buffer CE (pre-heated to 70 C) onto the membrane; 23. Incubate for 5min at room temperature (18–25 C); 24. Centrifuge for 1min a 11,000 g; 25. Proceed with amplification or keep frozen until fur- ther processing. 8.1.3.2. Amplification. This protocol utilizes a dual- indexing strategy (Kozich et al., 2013) amplifying the ITS2 region, using the primers ITS-S2F (Chen et al., 2010) and ITS4R (White et al., 1990), but can be adapted to amplify other markers (Bell et al., 2019). The primer sequences are as follows: forward: 50- AATGATACGGCGACCACCGAGATCTACAC XXXXXXXX CCTGGTGCTG GT ATGCGATACTTGGTGTGAAT-30; reverse: 50- CAAGCAGAAGACGGCATACGAGAT XXXXXXXX AGTCAGTCAG CC TCCTCCGCTTATTGATATGC- 30, where XXXXXX indicates the variable index sequences (Table 36). The detailed protocol is described below: 1. Sample index combinations should be planned before- hand according to the scheme in Figure 41; Table 39. Protein content (%) using different distillation times. Distillation time (min) Protein content (%) n¼ 5 4 20.48 (± 0.07)a 3 20.29 (± 0.25)a 2 20.41 (± 0.04)a Figure 38. Base peak chromatograms of (a) cherry wine and (b) Cabernet Sauvignon-Central Serbia in positive ion mode. (Pantelic et al., 2014). Standard methods for pollen research 55 2. Prepare 3 10 ml reaction mixes for each sample con- taining (also see PCR sample design below for details): a. 5 ml 2 Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) or equivalent; b. 0.33 mM each of the forward and reverse primers (sample-specific combinations of forward and reverse index sequences); c. 3.34 ml PCR grade water; d. 1 ml DNA template. 3. Carry out the PCR with a program of: a. 95 C for 4min, then; b. 37 cycles of 95 C for 40 sec; c. 49 C for 40 sec; d. 72 C for 40 sec. and e. a final extension at 72 C for 5min. 4. Combine the triplicate PCR reactions of each sample and mix well. For quality control purposes, successful amplification can be checked on a 1% agarose gel using 5 ml of the combined PCR product. The design used in 96-well PCR sample is: Design 1: Well-equipped laboratories with pipet- ting robots or 96-channel pipettes can directly fill each well with a different sample and generate three replicates of these. This will result in 4 3 replicateFigure 39. Extracted ion chromatograms and MS/MS spectra ofcyanidin-3-rutinoside (Pantelic et al., 2014). Figure 40. (a) Extracted ion chromatograms of phenolic glyceride derivatives with their retention times and accurate masses; (b and c) mass spectra of two phenolic glyceride derivatives with the same accurate masses, m/z 413 (Ristivojevic et al. 2014). 56 M. G. Campos et al. Figure 41. Planning scheme for samples and the corresponding index-combinations. Roman numbers indicate PCR plate numbers, bold Arabian numbers on 96 well plates indicate normalization plate number. Figure 42. Detailed workflow (schematic), suitable for laboratories with limited access to equipment for automated pipetting. Bold numbers indicated step number of Design 2 in Section 8.1.3.2. Standard methods for pollen research 57 96-well plates according to Figure 41 used for amplifi- cation. After amplification one can proceed with normalization. Design 2: For laboratories with little equipment for automated pipetting, the workflow described above is impractical, since manual pipetting in that format is time-intensive and pipetting errors can be easily intro- duced. To facilitate the process, we recommend to work with all triplicates but only 24 samples on one 96 well plate (Figure 42). This way, 16 PCR plates will be produced, but pipetting effort is minimized. PCR plate labeling is therefore of utter importance, for example with roman numbers, I – XVI to be able to map the samples back to the scheme in Figure 41. The complete workflow is shown schematically in Figure 42 and described in the following: 1. Prepare two PCR master mixes, each containing one forward primer, corresponding to the samples you want to amplify; each master mix contains: a. 200 ml 2 Phusion Master Mix (New England Biolabs, Ipswich, MA, USA) or equivalent. b. 13.2 ml forward primer (10 mM). c. 133.6 ml PCR grade water. 2. Place a new PCR plate into a cooling block; 3. Distribute 26 ml of the master mixes into row A (Master Mix 1) and F (Master Mix 2); 4. Add 1 ml of the correct reverse primer; 5. Add 3 ml of the correct DNA template; 6. Using a pipette set to 10 ml, pipette up and down to mix and distribute 10 mL each into the two rows below: from row A into rows BþC; from row F into rows GþH; 7. Seal with a foil, spin down briefly; 8. Perform PCR; 9. Prepare a 1% agarose gel; 10. After PCR, briefly spin down again; 11. Lift the foil carefully and combine the triplicate reac- tions, pipette up and down to mix; 12. For gel electrophoresis, add 1 ml of 6 loading buffer into the so far unused rows Dþ E; 13. Add 5 ml PCR product to the loading buffer; 14. Briefly spin down; 15. Load the gel, add a DNA ladder; 16. Run the gel (e.g., 25min, 120 V); 17. Check under UV illuminator for successful PCR amplification; 18. Freeze PCR product until further processing; 19. Continue with normalization. 8.1.3.3. Normalisation. To ensure more equalized library sizes, DNA amounts in each PCR product are normalized using the SequalPrepTM Normalisation Kit (Invitrogen, Carlsbad, CA, USA). For 384 samples, four normalization plates are needed. After normalization, samples from each plate will be combined in “plate pools” for the following quality control. Design 1: Pool the samples of all three repli- cates together by keeping the sample scheme. Transfer 25 ml of PCR products onto the normal- ization plates. Proceed with the normalization as described below. Design 2: For normalization, PCR plates I – IV; V – VIII; IX – XII and XIII – XVI will be combined to nor- malization plates 1, 2, 3 and 4. The pipetting scheme is as follows: 1. Thaw the PCR plates. 2. Briefly spin down. 3. Use four normalization plates and add 25 mL of PCR product into the wells following this scheme. a. Normalization Plate 1: PCR plates I –IV b. PCR plate I: row A !row A; row F ! row B c. PCR plate II: row A !row C; row F ! row D d. PCR plate III: row A !row E; row F ! row F e. PCR plate IV: row A !row G; row F !row H f. Repeat analogous for the other three normaliza- tion plates. g. Proceed with the normalization as described below. Design 1 & 2: Continue for both designs with the normalization: 1. Add 25 ml of Binding buffer; 2. Mix by pipetting up and down or seal the plate with foil tape, vortex to mix and briefly centrifuge the plate; 3. Incubate for 1 hour at room temperature; alterna- tively leave to incubate overnight; 4. Aspirate liquid from wells, do not scrape the well sides; 5. Add 50 ml Wash buffer, mix by pipetting up and down; 6. Completely aspirate the buffer from wells, you may need to invert and tap the plate on paper towels; 7. Add 20 ml of Elution buffer; 8. Mix by pipetting up and down or seal the plate with foil tape, vortex and briefly spin down; 9. Incubate for 5min at room temperature; 10. Combine 5 ml of each sample (plate-wise) in a new microcentrifuge tube, mix well; 11. Prepare 1:10 dilutions of each plate pool; 8.1.3.4. Quality control and quantification. Quality control is performed on a Bioanalyzer High Sensitivity DNA Chip (Agilent Technologies, Santa Clara, CA, USA) to ensure that the correct fragment size (peak at approximately 450 bp; target plus adapters) has been amplified. Additionally, libraries are quantified using the dsDNA High Sensitivity Assay on the Qubit fluorometer (both Life Technologies GmbH, Darmstadt, Germany) in order to combine the four plate pools equimolarly to the final sequencing library. We recommend preparing 58 M. G. Campos et al. three independent concentration measurements per plate pool. Bioanalyzer: 1. Prepare a Bioanalyzer Chip according to the protocol; 2. Allow all reagents to equilibrate to room temperature; 3. If not ready, prepare a gel-dye mix; 4. Add 15 ml of the dye concentrate (blue lid) to a gel matrix vial (red lid); 5. Vortex well and spin down, transfer to spin filter; 6. Centrifuge at 2240 g for 10min; 7. Protect solution from light, store at 4 C, use within 6 weeks; 8. Put a new chip on the chip priming station; 9. Pipette 9 ml gel-dye mix into the well marked with a white “G”; 10. Close the chip priming station, with the plunger at position 1ml; 11. Press plunger until held by the clip; 12. Wait for 60 s then release clip; 13. After 5 s slowly pull back the plunger to the 1ml position; 14. Open the priming station, pipette 9ml gel-dye mix in the wells marked with black ‘G’s; 15. Pipette 5 ml marker (green lid) into all sample wells and the ladder wells; 16. Pipette 1 ml of ladder (yellow lid) in the well-marked with a ladder symbol; 17. In each sample well, pipette 1 ml of sample (concen- trated and diluted Plate pools) or 1 ml marker (unused wells); 18. Put the chip horizontally in the adapter and vortex for 1min at 2400 rpm; 19. Run the chip within 5min; 20. The samples are of sufficient quality, if the electrophero- grams show a single peak at approximately 450bp; this peak can be rather wide due to different lengths of the ITS2 region, a minor peak shortly after the lower marker is acceptable and corresponds to left-over pri- mer dimers, which will not interfere with sequencing. 8.1.3.5. Quantification. 1. Measure concentrations of plate pools with the dsDNA High Sensitivity Assay on the Qubit Fluorometer. 2. Mix 1 n ml Qubit reagent with 199 n ml Qubit buffer (working solution). 3. For each measurement, mix 180–199 ml working solu- tion with 1–20 ml sample. 4. Vortex and incubate at room temperature for 2min. 5. Combine plate pools to final library equimolarly, start- ing with the least concentrated library of which take 20 ml. 6. Quantify the final pool and dilute to 2 nM, if final pool contains less than 2 nM proceed without dilution. 8.1.4. Sequencing Before sequencing, a sample sheet has to be prepared. This can be done at the MiSeq instrument using the Illumina Experiment Manager (IEM). However, due to the high number of samples, we recommend to pre- pare the sample sheet in advance, which can be done on a different computer with the IEM installed, and load it on to the MiSeq instrument when starting the sequencing procedure. Due to using custom index sequences, a new assay has to be added to the IEM, this is described in the Supplemental Material of Kozich et al. (2013). For library dilution, we follow the Illumina Sample Preparation Guide for a 2 nM library, with some modifi- cations. In order to increase read quality, 5% PhiX con- trol is added to the sample library. Additionally, the reagent cassette of the sequencing kit (e.g., Illumina MiSeq Reagent Kit v2 2 250 bp) is spiked with the cus- tom Read1, Read2 and index primers (for primer sequences, see Table 1). 8.1.4.1. Sample library. 1. Remove Buffer HT1 from freezer. 2. Prepare a fresh dilution of 0.15 N NaOH (less than a week old). 3. Mix 5ml of the sample library with 5 ml of 0.15 N NaOH. 4. Vortex briefly and centrifuge at 280 g for 1min. 5. Incubate at room temperature for 5min. 6. Add 990 ml Buffer HT1 (10 pM library). 7. Mix 480 ml of 10 pM library and 120 ml Buffer HT1 (8 pM library). 8.1.4.2. PhiX control. 1. Thaw PhiX control at room temperature. 2. Mix 2 ml 10 nM PhiX control with 3 ml H2O (4 nM PhiX). 3. Add 5 ml 0.15 N NaOH. 4. Vortex briefly and centrifuge at 280 g for 1min. 5. Incubate at room temperature for 5min. 6. Add 990 ml Buffer HT1 (20 pM PhiX). 7. Mix 375 ml of 20 pM PhiX and 225 ml Buffer HT1 (12.5 pM PhiX). 8. Mix 570 ml 8 pM library with 30 ml 12.5 pM PhiX. 8.1.4.3. Preparing reagent cassette and loading the sample. 1. Remove the reagent cassette from the freezer. 2. Rename the sample sheet to match the barcode of the reagent cassette. 3. Place in water bath, do not fill higher than maximum water line. 4. Prepare 3 ml each of Read1, Read2 and index pri- mers in new microcentrifuge tubes. 5. Remove cassette from water bath, dry with paper towel. 6. Invert the cassette several times to mix. Standard methods for pollen research 59 7. Inspect wells, make sure all reagents are thawed and there are no precipitates. 8. Gently tap the cassette on the bench to remove air bubbles. 9. With a 1000 ml pipette tip, break the foils over wells 12–14 and well 17. 10. With a 100 ml pipette set to 75 ml, transfer the read and index primers to the following wells of the reagent cartridge: Read1 ! Well 12; Index ! Well 13; Read2 ! Well14, mix well by pipetting up and down. 11. Load 600 ml of the spiked library to well 17. 12. Load the cassette, PR2 bottle and flow cell as prompted by the instrument. 13. Sequence. 8.2. Bioinformatics 8.2.1. Required software a. up to date Linux or Unix-based OS. b. usearch, version v11 (Edgar, 2010), if necessary add location to your system PATH. c. SeqFilter, https://github.com/BioInf-Wuerzburg/SeqFilter d. usearch additional python scripts, https://drive5. com/python 8.2.2. Classification 8.2.2.1. Reference databases. a. Reference database for direct classification We recommend to first use a reference database that is most specific to your project design and limited in represented taxa. This helps strongly with the quality of the assignments. Examples for restrictions are species lists for the biogeographic region or specific taxonomy groups of interest. Such databases can be created with the BCdatabaser software (Keller et al., 2020). If you have unpublished sequences of your laboratory that should be considered as well, add them into this file. a. Reference database for hierarchical classification All remaining sequences not classified with the direct database can be additionally classified to a hierarchical taxonomic level as deep as possible. For this it is important to have a database that covers all taxonomic groups. One such database could be for ITS2 accessible under the DOI https://doi.org/10.5281/zenodo. 3339028 which was also created with the BCdatabaser. Table 41. International data on the lipid content (% DM) of bee pollen. Crude lipid content (%D.M) Type of samples Number of samples Values References Multifloral 21 4.0–5.5 (Herbert & Shimanuki, 1978) Multifloral 3 2.0–18.0 (Echigo et al., 1986) Multifloral 20 4.8–7.1 (Serra-Bonvehı & Escola Jorda, 1997) Monofloral 172 0–11.2 (Somerville, 2001) Multifloral 15 3.6–8.9 (Villanueva et al., 2002) Multifloral 10 7 ± 2 (Almeida-Muradian et al., 2005) Multifloral 6 batches 4.97 (Melo et al., 2005) Multifloral (Korea) 9 3.3–9.8 (Szcze^sna, 2006a) Multifloral (China) 5 3.5–8.8 (Szcze^sna, 2006b) Multifloral (Poland) 13 6.74–10.99 (Szcze^sna, 2006c) Multifloral 154 4.0–13.3 (Martins et al., 2011) Multifloral 7 4.3–5.0 (Stanciu et al., 2012) Multifloral 14 6.3–8.7 (Balkanska & Ignatova, 2012) Monofloral 12 0.6–6.5 (Yang et al., 2014) Multifloral 7 batches 5.39 ± 0.60 (Arruda et al., 2013) Multifloral 99 1.15–6.97 (Liolios et al., 2014) Monofloral 43 0.4–13.6 (Liolios et al., 2014) Average and standard deviation;  Average. Table 40. Protein content (%) analyzing different quantities of pollen. Pollen quantity (g) Protein content (%) n¼ 5 0.5 19.12 (± 0.16)b 1 20.59 (± 0.03)a 2 20.64 (± 0.06)a Different letter shows statistically significant changes (Duncan’s mul- tiple range test, a¼ 0.005). Table 42. Total lipid content (%) by using different amount of pollen for the analysis. Pollen amount (g) Total lipid content % (n¼ 5) 1 2.24 (±0.113)a 2 2.87 (±0.056)b 3 2.83 (±0.098)b The elution time was equal (5 h) and the petroleum ether served as solvent. Different Latin letter indicates statistically significant differ- ences, according to Duncan’s multiple range test (a¼ 0.05). Table 43. Total lipid content (%) in pollen samples, by using different elution times (3 h, 5 h, 7 h). Elution time (h) Total lipid content % (n¼ 5) 3 2.56 (±0.080)a 5 2.95(±0.040)b 7 2.96 (±0.025)b The pollen amount was 2 g and the petroleum ether served as solv- ent. Different Latin letter indicates statistically significant differences, according to Duncan’s multiple range test (a¼ 0.05). 60 M. G. Campos et al. 8.2.2.2. Preparation and classification of sequencing data. The sequence reads created in step 2.3.5 have to be joined, quality filtered and classified. For this purpose: 1. Copy all R1 and R2 fastq files and the reference database folders into a single folder. 2. Navigate on the command line shell to this folder. 3. Merge forward and reverse reads: usearch -fastq_mergepairs R1.fastq \ -relabel @ \ -fastq_minmergelen 150 -fastq_maxmergelen 350 \ -fastqout analyse_merged.fq -fastq_maxdiffs 15 4. Quality filtering and format parsing: usearch -fastq_filter analyse_merged.fq -fastq_maxee 1 -fastaout reads.fa sed"s/>\([a-zA-Z0-9-]\)\.\([0-9]\)/>1_\2;barcodelabel¼\1;/g"\ reads.fa>reads_bc.fa 5. Cluster amplicon sequence variants: usearch -fastx_uniques reads_bc.fa \ -sizeout -minuniquesize 3 -fastaout reads_bc.derep.fa usearch -sortbysize reads_bc.derep.fa \ -fastaout reads_bc.derep.sort.fa usearch -unoise3 reads_bc.derep.sort.fa \ -zotus reads_bc.zotus.fa \ -tabbedout unoise3.txt 6. Classify with direct reference database: usearch -usearch_global reads_bc.zotus.fa \ -db PATH-TO-DIRECT-DB/sequences.tax.fa \ -id 0.97 -uc reads_bc.zotus_direct.uc -strand both 7. Classify remaining unclassified sequences with hierarchical reference database: grep "N" reads_bc.zotus_manRefs.uc j cut -f 9 > nohits SeqFilter reads_bc.zotus.fa --ids nohits \ -o reads_bc.zotus.nohits.fa usearch -sintax reads_bc.zotus.nohits.fa \ -db PATH-TO-HIERARCHICAL-DB/sequences.tax.fa \ -tabbedout reads_bc.zotus.sintax -strand plus \ -sintax_cutoff 0.8 8. Combine classifications: cut -f1,4 reads_bc.zotus.sintax> reads_bc.zotus.sintax.cut cat reads_bc.zotus.sintax.cut j \ sed -E -e "s/\_[0-9]þ//g" -e "s/,s:.$//" \ > reads_bc.zotus.sintax.cutx cut -f 9,10 reads_bc.zotus_ direct.uc j \ grep -v "" j sed "s/[A-Za-z0-9];tax¼//" \ > reads_bc.zotus.cutx echo ",kingdom,phylum,order,family,genus,species" > header.cutx cat header.cutx reads_bc.zotus.cutx \ reads_bc.zotus.sintax.cutx>taxonomy.data 9. Count read abundance in the sample data: usearch -usearch_global reads_bc.fa -strand plus \ -db reads_bc.zotus.fa -id 0.97 -uc zotus.uc python2.7 PATH-TO-PYTHON-SCRIPTS/uc2otutab.py sample_zotus.uc \ > combined.txt sed -e "s/OTUId//" combined.txt>combined.out This procedure will end with the following final files used for further analyses: (a) combined.out (the abundance of each taxonomic unit in the samples) (b) taxonomy.data (taxonomy assignments) Standard methods for pollen research 61 Table 45. Literature data on the carbohydrate content of bee pollen calculated as: 100 – (g fatþ g proteinþ g ashþ g water) (g/ 100 g DM). Type of samples Number of samples Values References Monofloral (Aloe greatheadii var. davyana) 6 59.5 (±1.3) Human and Nicolson (2006) Multiflora 22 67.7 (±2.6) 61.2–70.6 Feas et al. (2012) Multifloral 8 69.68–84.25 Nogueira et al. (2012) Monoflora (Brasica napus L., Citrullus lanatus L., Camellia japonica L., Dendranthema indicum L., Fagopyrum esculentum L., Helianthus annus L., Nelumbo nucifera Gaertn., Papaver rhoeas L., Rosa rugosa, Schisandra chinensis, Vicia faba L., Zea mays L.) 12 59.43–77.82 Yang et al. (2014) Multifloral – 13–55 Bogdanov (2015) Multifloral 26 64.42–81.84 Kostic et al. (2015) Average and standard deviation; min – max. Table 44. Total lipid content (%) in pollen samples, by using different solvents (acetone, pet- roleum ether, hexane). Solvent Total lipid content % n¼ 5 Acetone 2.99 (±0.155)a Petroleum ether 2.91 (±0.084)a Hexane 2.9 (±0.268)a The pollen amount was 2 g and the elution time was 5 h. Table 46. Literature data on the content of sugars in bee pollen (g/100 g DM). Type of samples/ Country of origin Number of samples Sugars Values Method used References Multiflora (with a predominance of Cistus landaniferus)/ Spain 20 Fructose 15.20–23.90 GC-FID Serra-Bonvehı & Escola Jorda (1997) Glucose 10.86–18.19 Saccharose 4.20–9.40 Maltose 0.79–3.20 F/G 1.13–1.53 Multifloral/Poland 95 Fructose 13.38–21.80 GC-FID SzczeRsna et al. (2002)Glucose 5.99–18.17 Saccharose 3.74–7.59 Maltose 0.96–3.32 F/G 1.03–2.51 Multifloral/ Poland, South Korea, China 27 Fructose 9.74–22.06 HPLC-RID SzczeRsna (2007)Glucose 8.45–20.06 Saccharose 1.13–4.84 Maltose 1.07–3.51 F/G 1.02–1.63 Multifloral/Israel, China, Romania, Spain 5 Fructose 15.9–19.9 HPLEC-PAD Qian et al. (2008)Glucose 8.2–13.1 Saccharose 14.8–18.4 F/G 1.33–1.66 Multifloral/Romania - Fructose 19.31 HPLC-RID Bobis et al. (2010)Glucose 17.86 Saccharose 0.85 Maltose 0.64 Multifloral/Brazil 154 Fructose 12.59–23.62 HPLC-RID Martins et al. (2011)Glucose 6.99–21.85 F/G 1.01–2.24 Multifloral/Romania 16 Fructose 8.44–15.39 HPLC-RID Margaoan et al. (2012) Glucose 4.37–16.14 F/G 0.78–1.44 Monofloral (Cucurbita pepo Thunb, Phoenix dactylifera L., Helianthus annus L., Medicago sativa L., Brasica napus L.)/ Saudi Arabia - Fructose 17.13–21.30 HPLC-RID Taha (2015)Glucose 15.44–17.06 F/G 1.07–1.25 min – max; average; no information; fructose to glucose ratio; results for fresh pollen. 62 M. G. Campos et al. These files can be loaded directly into R with the package phyloseq (McMurdie & Holmes, 2013). In add- ition, also the results of the intermediate steps are retained and can be used for troubleshooting, archiving or further analyses. 8.3. Data analysis 8.3.1. Required software a. Up to date R distribution (R Core Team, 2014). b. R package: phyloseq (McMurdie & Holmes, 2013); https://joey711.github.io/phyloseq 8.3.2. Prepare sample meta-data Additionally, to the sequencing data, phyloseq is intended to read in a meta-data file. This can be a simple spreadsheet in csv format with any number of variables to be investigated. For example, continuous vectors like “altitude” or “temperature” or categorical factors as “bee species” or “site” can be used. For this, open the file with your preferred text-editor or spreadsheet applica- tion and add columns according to the sampling design. Save the file again in tab-separated format. 8.3.3. Importing data The data generated above can be directly imported into R as a phyloseq class object. This allows a variety of analytical procedures and is recommended. However, other software tools handling community datasets may be equally well used for the task of analyses. The fol- lowing are R scripts, which can be directly used on the console: Table 47. Methods used to evaluate the vitamin content of bee pollen. Method Vitamins analyzed Country Reference Vitamin content (mean) Open column chromatography and microfluorimetric method C, beta-carotene as provitamin A Brazil Almeida-Muradian et al., 2005 Absence of vitamin C and beta-carotene (dried bee pollen) Open column chromatography and titrimetric method E, C and beta-carotene as provitamin A Brazil Oliveira et al., 2009 13,5mg/g (E); 56,3–198,9 mg/g (beta- carotene); 273,9–560,3 mg/g (C) (fresh bee pollen) HPLC, open column chromatography and titrimetric method E, C and beta-carotene as provitamin A Brazil Melo et al., 2009 114–340mg/g (C); 16,27–38,64 mg/g (E); 3,14–77,88 mg/g (beta carotene) (dried bee pollen) HPLC, open column chromatography and titrimetric method E, C and beta-carotene as provitamin A Brazil Melo & Almeida- Muradian, 2010 14–119 ug/g (C); 19.43–37.19 mg/g (E); 5.95–99.27 mg/g (beta- carotene) (fresh bee pollen) HPLC method with fluorescence detection. B1, B2, B6 and PP Brazil Arruda et al., 2013a; Arruda et al., 2013b 0.64mg/100 g (B1); 0.60mg/100 g (B2); 12.18mg/100 g (PP); 0.55mg/100 g (B6) HPLC and titrimetric method E (alpha, beta, gamma and delta tocoperol), C (ascorbic acid) and provitamin A (alpha and beta-carotene) Brazil Sattler, 2013 60–797 mg/g (C); 0.57–11.7mg/100g (E); 0–179.21 mg/g of beta- carotene; 0–828.43 mg/g of alpha-carotene HPLC method with fluorescence detection. Brazil Souza, 2014 0.46–1.57mg/100g (B1); 0.40–1.86mg/100g (B2); 2.67–7.74mg/100g (PP or B3);0.78–7.13mg/ 100g (B6) Table 48. Calibration curves obtained for echimidine, lycopsamine and intermedine. Echimidine or Lycopsamine or Intermedine (mg/ml) Echimidine (intensity) Intermedine (intensity) Lycopsamine (intensity) 0.02 2950 3130 3670 0.1 13660 15540 16200 0.5 63940 62050 71200 2 243800 200400 277000 Calibration curve y¼ 122755x þ 686 y¼ 104410x þ 1900 y¼ 138740x þ 1143 Weighted by 1/x. Standard methods for pollen research 63 1. Load packages and data: library(phyloseq) # load the package setwd("") # data folder tax <- tax_table(as.matrix(read.table("taxonomy.data", header¼T,row.names ¼ 1,fill¼T,sep¼","))) otu <- otu_table(read.table("zotu_table.txt", header¼T, row.names ¼ 1), taxa_are_rows¼T) map <- sample_data(read.table("microbiome_DATA_SamBoff.csv", sep¼",", header¼T, row.names ¼ 1,fill¼T)) data <- merge_phyloseq(otu, tax, map) # create phyloseq object 2. Adjust for missing taxa names in hierarchical classification: tax_table(data)[tax_table(data)[,"phylum"]¼¼"","phylum"]<- paste( tax_table(data)[tax_table(data)[,"phylum"]¼¼"","kingdom"], "_spc",sep¼"") tax_table(data)[tax_table(data)[,"order"]¼¼"","order"]<- paste(tax_table( data)[tax_table(data)[,"order"]¼¼"","phylum"], "_spc",sep¼"") tax_table(data)[tax_table(data)[,"family"]¼¼"","family"]<- paste( tax_table(data)[tax_table(data)[,"family"]¼¼"","order"], "_spc",sep¼"") tax_table(data)[tax_table(data)[,"genus"]¼¼"","genus"]<- paste( tax_table(data)[tax_table(data)[,"genus"]¼¼"","family"], "_spc",sep¼"") 3. Combine Amplicon Sequence Variants to species or genus level: (data.genus <- tax_glom(dataset.comp, taxrank¼"genus")) (data.species <- tax_glom(dataset.comp, taxrank¼"species")) 4. Transform to relative abundances and filter low abundance taxa: data.genus.rel¼transform_sample_counts(data.genus, function(x) x/sum(x)) otu_table(data.genus.rel)[otu_table(data.genus.rel)<0.01 ]<-0 Table 49. Retention and mass characteristics of known Echium-type and Eupatorium-type PAs (free bases/-N-oxides and isomers). PA peak n Compound Name RT (min) Chemical formula [MþH]þ experimental [MþH]þ calculated Error (mDa)  Echium vulgare 1 Echimidine 2.28 C20H31NO7 398.2184 398.2179 0.5 Echimidine-N-oxide 2.27 C20H31NO8 414.2126 414.2128 0.2 Acetylechimidine 2.74 C22H33NO8 440.2282 440.2284 0.2 3 Acetylechimidine-N-oxide 2.71 C22H33NO9 456.2234 456.2234 0.0 Echivulgarine 3.81 C25H37NO8 480.2575 480.2575 0.0 5 Echivulgarine-N-oxide 3.83 C25H37NO9 496.3402 496.3405 0.3 Vulgarine 2.33 C20H31NO7 398.2174 398.2179 0.5 2 Vulgarine-N-oxide 2.43 C20H31NO8 414.2133 414.2128 0.5 Acetylvulgarine 2.88 C22H33NO9 440.2285 440.2284 0.1 4 Acetylvulgarine-N-oxide 2.87 C22H33NO9 456.2243 456.2234 0.9  Eupatorium cannabinum 6 Lycopsamine 1.12 C15H25NO5 300.1807 300.1811 0.4 7 Intermedine 1.16 C15H25NO5 300.1810 300.1811 0.1 8 Lycopsamine-N-oxide or Intermedine-N-oxide 1.27 C15H25NO6 316.1756 316.1760 0.4 9 Lycopsamine-N-oxide or Intermedine-N-oxide 1.35 C15H25NO6 316.1758 316.1760 0.2 Distinction between the N-oxides of intermedine and lycopsamine not possible due to the lack of standards. 64 M. G. Campos et al. After completion of the tasks above, the dataset is in a condition where individual analyses can be started. The tutorials at the repository of phyloseq ((McMurdie & Holmes, 2013); https://joey711.github.io/phyloseq) provide a good starting point for this. 8.3.4. Recommended packages for further analysis Whilst phyloseq provides basic tools suited for most purposes, the modularity of R packages allows a variety of more and deeper analyses. It is not possible to dis- cuss all the features here, yet we provide a list some of the major packages relevant for community ecology and pollination studies: a. vegan: comprehensive community ecology package; b. picante: phylogenetic diversity indices; c. bipartite: interaction network ecology; d. edgeR: sequencing library size correction. 9. Standard method for the determination of protein content of pollen using the Kjeldahl method 9.1. Introduction The knowledge of bee pollen chemical composition increases the commercial value of the product. Especially, among the chemical constituents of bee pol- len, the proteins’ concentration has been the most studied (Table 37). There seems to be a considerable variation among the results regarding the protein con- centration, probably because of the different number of the analyzed samples and whether the pollen samples are unifloral or polyfloral. For the determination of the total protein content, the majority of authors use the Kjeldahl method modi- fied for bee pollen analysis by Rabie et al. (1983). However, the method of analysis has not been investi- gated. Regarding the calculation of the nitrogen content in this type of samples, several authors used different factors (6.25 or 5.60). Indeed, Rabie et al. (1983), rec- ommended the factor 5.60, while Serra-Bonvehı and Escola Jorda (1997) stated that the use of factor 6.25 would overestimate the protein content of analyzed samples. The follow methods elucidate the optimum conditions, in order to minimize the reagents’ consump- tion and the sample quantity. 9.2. Determination of protein content by Kjeldahl method 1. Weigh 1 g of bee pollen. 2. Heat the sample with 20ml of sulfuric acid (95–97%) at the presence of a catalyst (potassium sulfate, cop- per sulfate) for about 4 h until the solution becomes clear and blue-green in color. 3. Neutralize the digested sample with 90ml NaOH (30%) and distillate the solution for 2min using for the trapping of NH3, 30ml of H3BO3 solution (4%). 4. Titrate with HCl solution (0.1 M). The nitrogen content is determined by the consumption of the HCl solution (0.1M) during the titration. The crude pro- tein content is estimated using the most suitable factor 5.60, which was calculated and suggested by Rabie et al. (1983) after amino-acids analysis in different pollen species. 9.3. Development of the method For the development and validation of the suggested method, bee pollen of Papaver rhoeas was used. In order to find the optimum conditions for the determination of the protein content of bee pollen tests were applied regarding the volumes of NaOH, and H3BO3 solutions, the quantity of sample and the distillation time. 9.3.1. Volume of NaOH solution During the distillation, the NaOH solution converts any nitrogen in the bee pollen into NH3, while the appear- ance of the blue color demonstrates a sufficient volume of the solution for this formation. Volumes of 50ml, 60ml, 70ml, 80ml, 100ml and 110ml were tested. No change of color was observed in volumes of 50ml to 80ml, while in volume of 90ml, the color turned from light green into dark blue indicating the end of the reac- tion. The volumes of 100ml and 110ml were rejected, to avoid the unnecessary consumption and to reduce the cost of the analysis. Thus, the suitable volume of the NaOH solution (30%) was determined at 90ml. Table 50 MS/MS fragment ions for PA-N-oxides from E. vulgare or E. cannabinum. Pyrrolizidine alkaloid [MþH]þ MS/MS fragment ions  Echium vulgare Echimidine-N-oxide 414.2126 396.2029, 352.1764, 338.1608, 254.1403, 220.1350, 120.0817 Acetylechimidine-N-oxide 456.2234 438.2131, 396.2025, 338.1610, 254.1393, 220.1339 Echivulgarine-N-oxide 496.3402 478.2448, 396.2030, 338.1613, 254.1397, 220.1341, 120.0816 Vulgarine-N-oxide 414.2133 396.2021, 314.1612, 256.1189, 172.0976, 138.0923, 136.0764 Acetylvulgarine-N-oxide 456.2243 438.2132, 356.1714, 298.1295, 214.1081, 180.1030, 120.0818  Eupatorium cannabinum Lycopsamine/Intermedine-N-oxide 316.1756 172.0973, 155.0947, 138.0917, 111.0684 Standard methods for pollen research 65 9.3.2. Volume of H3BO3 solution Boric acid is used for the capture of NH3, during distil- lation. Volumes of 30ml and 40ml were tested without statistically significant changes to be observed between the results (Duncan’s multiple range test, a¼ 0.05) (Table 38). Eventually, the volume of 30ml of the H3BO3 solution (4%) was chosen for the analysis. 9.3.3. Distillation time Different distillation periods of time (2, 3, 4min) were used in order to choose the most appropriate. In all cases, 1 g of sample, 90ml NaOH and 30ml H3BO3 were used. According to the statistical process of the results, no signifi- cant changes were observed in the protein content regard- ing to the distillation time (Table 39). For this reason, the shortest time of 2min was chosen for the analysis. 9.4. Sample preparation For the chemical analysis of bee pollen of a single plant, the pollen pellets should be separated from the mixture according to its color, shape and texture and this is a tedious and time consuming process. Consequently, the minimum amount of pollen for chemical analysis will reduce the needed time and facilitate the analysis. 1. Different quantities of pollen 0.5 g, 1 g and 2 g were tested with five replications in each case, maintaining the other parameters constant. 2. The volumes of 90ml NaOH and 30ml H3BO3 were used, while the distillation time was 2min. 3. Statistically significant changes were observed regard- ing to the protein content (Table 43). The minimum quantity of 0.5 g gave significantly less amount of pro- teins, while no differences were found when one or two grams were used. 4. After that, we propose the use of one gram sample for the analysis of proteins in bee pollen samples. 9.5. Validation of the method For the determination of the repeatability of the method: 1. eight pollen samples of Papaver rhoeas of the same quantity (1 g) were analyzed; 2. samples were treated equally during the three steps of the Kjeldahl method, as described previously; 3. average protein content of Papaver rhoeas pollen was found 20.6%, while the low value of RSD (0.81%) indi- cated the very good repeatability of the method. 9.6. Application of the method Pollen from different botanical species has different nutritional value for honey bees, affecting the development and the prod- uctivity of the bee colony. To investigate qualitative and quanti- tative differences on pollen composition we collected bee pollen samples from the apiary of Aristotle University in con- secutive years during the full season and samples from bee- keepers all over Greece. The samples were analyzed as a mixture or as separate pollen pellets that are classified accord- ing to their color, shape and texture. For the identification of the pollen microscopic method is applied. Monofloral and mul- tifloral bee pollen samples were analyzed using the method described above. Some of the results regarding the differences based on plant origin are presented below, in Figure 43. The lowest value was observed for Actinidia chinensis (9.7%) and the highest for Crocus sativa (26.1%). The range of 16.4%, confirms the large variation among pollen from different plants. The protein content of mixed bee pollen samples was also exam- ined during the whole beekeeping season, in order to find out differences based on the harvesting period (Figure 44). The mixed pollen samples collected from March till the middle of June indicated that the nutritional requirements of bees are very well met since the protein content ranged from 19.7% to 26.6%. Herbert (1992) mentions that a pro- tein content of 20–23% in pollen substitutes is ideal for the dietary requirements of honey bees. As opposed to that, pollen collected from the middle of June till the middle of September had average protein content below 20%, includ- ing the lowest observed value (14.8%) in the end of August. During autumn, the protein content of pollen increased again and exceeded 20%. According to these results, it is obvious that the protein content of mixed pollen ranges according to the season and this could affect the colony’s development and the quality of the bee product for sale. 10. Standard method for determination of lipid content of pollen using Soxhlet extraction 10.1. Introduction The lipid fraction is one of the basic constituents of bee pol- len and varies significantly among the different botanical spe- cies (Somerville, 2001; Yang et al., 2014). Several authors have studied the lipid concentration in pollen, whose results are referred in Table 41. The variations among the research observed, could be attributed to the different number of the analyzed samples and to variable botanical origin of the sam- ples. The most common method for the determination of the total lipid content of foods is the extraction method described by Soxhlet. According to this procedure, oil and fat are extracted by repeated elution with an organic solvent (extraction cycle). Nevertheless, in case of the extraction of lipids in pollen, there is vagueness about the optimum meth- odology concerning the reagent’s consumption, the sample quantity and the elution time. The following methods clarify these parameters and provide experimental results that should be implemented to produce reliable analytical data on lipids analysis of pollen. 10.2. Methodology for total lipid content determination The total lipid content is determined as crude fat from a solvent extract. 66 M. G. Campos et al. 1. weigh 2 g of bee pollen and place in a porous cellulose thimble (25 100mm). 2. place the thimble in an extraction chamber, which is suspend above a round bottom flask containing petrol- eum ether as solvent and below a condenser. 3. heat the flask – evaporate the solvent and move up into the condenser where it is converted into a liquid that trickle into the extraction chamber containing the sample. This extraction cycle is repeated many times for 5 hours. In order to remove the excess solvent. 4. fat residue is dried in an oven at 80 C for 45min until to constant weight. 5. place the flask for 15minutes in a desiccator which contains CaCl2, in order to cool down without absorbing moisture. 6. estimate the fat content as the difference in weight of the flask before and after the extraction. Express as percent of dry matter. 10.3. Development of the method For the development and validation of the previous method, pollen of Papaver rhoeas was chosen. 1. Pollen samples: collected from traps placed in bee hives (in this example they were located in the sur- rounding area of Thessaloniki). The specific plant taxon was chosen, because of its abundance in the area where the bee hives were located and its regular for- aging by the bees. Moreover, its pollen loads possess a distinct black color, so they can be separated easily from mixed pollen samples. 2. Determination of the optimum quantities of the mate- rials and the appropriate analysis’ conditions of the method – tests implemented regarding the pollen amount (1 g, 2 g, 3 g), extraction time (3 h, 5 h, 7 h) and the type of the solvent (acetone, petroleum ether, hexane). Statistically significant differences were found in total lipid content (Duncan’s multiple range test, a¼ 0.05), using different amounts of pollen (Table 42) and different elution times (Table 43), while no signifi- cant differences were observed by using different sol- vents (Table 44). Note: Considering that the separation of pollen samples based on color is a tedi- ous and time consuming process, the quantity of pol- len should minimize as possible. As a consequence, according to the Table 2, the amount of 2 g was chosen for the analysis. 3. Elution time the period of 5 h was chosen. The time of 7 h was rejected in order to reduce the time con- sumption, while when 3 h elution was applied statistic- ally significant differences were observed in the total lipid content. 4. Solvent extraction – no statistically significant differen- ces were found among the solvents and petroleum ether is widely referred in bibliography for the extraction of the lipids in pollen this liquid was chosen as the appropriate solvent. 10.4. Validation of the method For the determination of the repeatability of the method, Papaver rhoeas pollen was separated, homogen- ized and eight subsamples of 2 g analyzed under the same conditions (extraction time: 5 h, solvent: petrol- eum ether). The average liquid content of Papaver rhoeas was found 2.47%, while the relative standard deviation (RSD) was 4.66% indicating a satisfac- tory precision. 10.5. Application of the method The method described above was applied in monofloral and polyfloral pollen samples collected from University apiary. Some of the results regarding the differences based on plant origin are presented in Figure 45. The identification of pollen taxa was based on the micro- scopic characteristics (Lau et al., 2018; Louveaux et al., 1978). The lowest value was observed for Erica manipuli- flora (0.40%) and the highest for Echinops ritro (13.60%). The average of the samples examined was 4.61% and the range was 13.2%. The lipid content of mixed pollen samples was also examined during the whole beekeeping season, in order to find differences based on the harvesting time (Figure 46). The higher lipid content of mixed pollen samples was observed in samples collected between 19/9 until 15/10. Pollen collected early in autumn (13/9) has very low lipid content (2.15%) but after that, the lipid con- centration increases considerably to reach the high level of 6.22% on the day 15/10. One factor that may con- tribute to this increase is the second period of bloom- ing of Sisymbrium irio which is very reach in lipids (7.22%). The fluctuation of lipid curve of pollen mix- tures collected in different period of year (Figure 46) indicates the effect of various blossoms to the final chemical composition of pollen. 11. Determination of sugar content in pollen using HPLC-RID 11.1. Introduction Carbohydrates are the sugars, dietary fiber, and starch which constitute the main fraction of pollen dry matter and represent important components from the nutri- tional and energy point of view. Collected pollen pro- vides bees a valuable source of simple sugars and other carbohydrates which are essential for proper nutrition and advisable for certain physiological conditions. The generally accepted calculation for total carbohydrate content in pollen is: 100 – (g fatþ g proteinþ g ashþ g water) (Bogdanov, 2015; Feas et al., 2012; Human & Nicolson, 2006; Kostic et al., 2015; Nogueira et al., 2012; Yang et al., 2014) (Table 45). This calculation is Standard methods for pollen research 67 much higher than results received through HPLC or GC methods because they do not determine such com- ponents as dietary fiber, starch, and cell wall material. Studies dealing with the composition of sugars in pollen were concerned with the total content of reducing and non-reducing sugars (Cirnu et al., 1969; Rosenthal et al., 1969; Solberg & Remedios, 1980; SzczeRsna et al., 1995a, 1995b; Youssef et al., 1978). Advances in chromatographic techniques with differ- ent detections (TLC, HPLC-RID, HPTLC, HPLEC-PAD, HPLEC coupled to LC-ESI-MS, GC-FID; GC-MS) made it possible to analyze, in detail, the composition of sug- ars in bee pollen (Aratchi et al., 2018; Bobis et al., 2010; Echigo et al., 1986; Margaoan et al., 2012; Martins et al., 2011; Qian et al., 2008; Serra-Bonvehı et al., 1986; Serra-Bonvehı & Escola Jorda, 1997; SzczeRsna, 2007; SzczeRsna et al., 2002; Taha, 2015). The quality and quantity composition of pollen sugars was found to be closely related to the plant species of origin as well as to the methods of analysis. Researchers identified fourteen different sugars in pollen of which fructose, glucose, and sucrose occurred in the greatest amounts, followed by maltose (Table 46). The following compos- ition of basic sugars in bee pollen was determined to be: fructose 44–46%, glucose 35–37%, sucrose 8–30%,and maltose 5–10% of the total sugar content. Mono-, di- and trisaccharides furanose, arabinose, ribose, trehalose, isomaltose, turanose, kojibiose, gen- tiobiose, melibiose and melezitose accounted for about 1% (Aratchi et al., 2018; Serra-Bonvehı et al., 1986; Serra-Bonvehı & Escola Jorda, 1997; SzczeRsna, 2007; SzczeRsna et al., 2002). The metabolome analysis of bee- collected pollen, especially myo-inositol (predominant physiologica form of six-carbon sugar alcohol) and pen- tose sugars (furanose) is useful in the study of plant-pol- linators mutualism (Aratchi et al., 2018). Tetrasaccharide stachyose is also determined in pollen samples (Quian et al., 2008). The fructose-to-glucose ratio (F/G) of bee-collected pollen samples varies con- siderably from 1.01 in Brazil (Martins et al., 2011) to Figure 43. Crude protein content (% D.M) of bee pollen from selected botanical origins. Figure 44. Protein content (% D.M) of mixed pollen samples harvested during the beekeeping season of 2011. 68 M. G. Campos et al. Figure 45. Crude lipid content (% D.M) of bee pollen from selected botanical origins. Figure 46. Lipid content (% D.M) of mixed pollen samples harvested during the beekeeping season of 2013. Figure 47. (a) Structure of PAs: Necinic acids are connected to the necine base by ester bond in position 1 and/or 7. Necinic acids can be connected to form a macrocyclic ester; (b) Example of PA free base and N-oxide macrocyclic esters (Hartmann & Witte, 1995). Standard methods for pollen research 69 2.51 in Poland (SzczeRsna et al., 2002) (Table 46). The sugar content of pollen has not been normalized, and in fact only Poland, Switzerland and Argentina currently have a standard for it. The International Honey Commission proposes 4 g/100 g minimum sugar content for dried bee pollen (Campos et al., 2008). The HPLC technique with refractive index detection (RID) has gen- erally been used for the determination of sugars in bee- collected pollen (Bobis et al., 2010; Margaoan et al., 2012; Martins et al., 2011; SzczeRsna, 2007; Taha, 2015). 11.2. Method for identification and quantification of sugars by HPLC-RID 11.2.1. Principle This method is based on the procedure elaborated by Bogdanov et al. (1997) for the determination of honey sugars and adopted by SzczeRsna (2007). Briefly, the sugars are extracted from pollen samples and then, determined by HPLC with a refractive index detector (RID) using a normal-phase column containing amine-modified silica gel with a 5–7mm particle size. The analyzed sugars are: fruc- tose, glucose, saccharose, maltose, turanose, trehalose, izomaltose, erlose, melezitose, and rafinose. The sugars are identified through the comparison of individual sugars' retention times of the reference and the analyzed solu- tion. The quantitative assays are done by the external standard method comparing those sugars' peak surfaces. 11.2.2. Reagents a. deionized water (18.3 MX). b. methanol, acetonitrile for HPLC (J.T. Baker or com- parable purity from another company). c. analytical standards of: fructose, glucose, saccharose, maltose, turanose, trehalose, izomaltose, erlose, mele- zitose, rafinose (SIGMA-ALDRICH or comparable pur- ity from another company). d. Carrez solution I: 15 g of potassium hexacyanoferrate (II) trihydrate, K4Fe(CN)6 3H2O dissolved in 100ml of deionized water. e. Carrez solution II: 30 g of zinc acetate dihydrate, Zn(CH3COO)2 2H2O dissolved in 100ml of deion- ized water. 11.2.3. Equipment a. High Performance Liquid Chromatograph operated by computer software and equipped with: pump, degas- ser, autosampler, column-oven, and refractive index detector (RID). b. amine-modified silica gel HPLC column with 5–7 mm particle size (250 4.6mm 5 mm) (Phenomenex or another company). c. analytical balance. d. mechanical shaker. e. automatic dispenser. f. analytical grade filter paper. g. PVDF membrane filter, pore size 0.45 mm (Karl Roth or another company). h. volumetric flask, 100ml. i. Eylenmeyer flask, 100ml. j. beaker, 50ml. k. autosampler vial. 11.2.4. Preparation of stock standard solution and working standard solutions of sugars 1. weigh each sugar to prepare a standard solution, with an accuracy of 0.001 g. Weights of individual sugars: (a) fructose: 1.000 g, (b) glucose: 0.750 g, (c) sacchar- ose, maltose: 0.500 g, (d) turanose, trehalose, izomal- tose, erlose, melezitose, rafinose: 0.075g. 2. dissolve the standard sugars in a small amount of deionized water and transferred quantitatively to a volumetric 100ml flask. Add 25ml of methanol with the use of an automatic dispenser, and poured into a volumetric flask up to the mark with deionized water. 3. filter the standard solution with 0.45 mm membrane filter and stored at 18 C. A stock standard sugar solution kept at this temperature is stable for six months. Note: a calibration curve is used for the external standard method of the quantitative analysis of sugar in pollen. The calibration curve is prepared for three different concentra- tions of each analyzed sugar. For this purpose, the working standard solutions of those sugars are prepared on the day of analysis from the stock standard solution. 11.2.5. Sample preparation 1. weigh a pollen sample of 5 g ± 0.001 g and put into a 100ml Eylenmeyer flask. 2. add about 40ml of deionized water, 5ml of Carrez solution I, and 5ml of Carrez solution II and mix for 2 h at 30 C using a mechanical shaker. 3. transfer the solution quantitatively to a 100ml volu- metric flask, add 25ml of methanol and filled up to the notch, with deionized water. 4. filter the sample solution through qualitative filter paper into a beaker. The first 10ml of the filtrate are discarded. The solution is passed through a 0.45 lm membrane filter into an autosampler vial and the fil- trate injected in the HPLC-RID system. 11.2.6. HPLC-RID analysis The HPLC system is run using computer software in the following conditions: 1. flow rate: 1.5ml/min. 2. mobile phase: acetonitrile: water (80:20 V/V). 3. column and detector temperature: 30 C. 4. injection volume: 20 ml. After the HPLC System is stabilized, the working standard solutions of the sugars and then pollen sample 70 M. G. Campos et al. are injected and analyzed under the same conditions. The external standard method is used to calculate the results using a calibration curve determine for three dif- ferent concentrations of each sugar standard. The results are express as g/100 g to one decimal place. 11.3. Validation of the method The method described above can be applied for routine analysis of fructose, glucose, saccharose, maltose, turanose, trehalose, izomaltose, erlose, melezitose, and rafinose in pollen samples. The detection limit, working range, linear- ity, repeatability and within-laboratory reproducibility were determined for this method. The detection limit was set at 0.2 g/100 g DM for fructose and glucose and at 0.5 g/ 100 g DM for saccharose, maltose, turanose, trehalose, izo- maltose, erlose, melezitose, and rafinose. This procedure is used for the routine determination of sugars in pollen, in the range of: 5–40 g/100 g for fructose and glucose; 0.5–30 g/100 g for saccharose, maltose, trehalose, tura- nose, and isomaltose; 0.5–10 g/100 g for erlose, rafinose and melecytoze. The correlation coefficient of the linear dependence of sugar concentration and peak area in the working range, reached the value of over 0.995 for all the analyzed sugars. A series analysis for three pollen samples showed that the variation coefficient of the repeatability and the within-laboratory reproducibility of the elaborated method did not exceed 10% for fructose and glucose, and 20% for both other analyzed disaccharides (saccharose, maltose, turanose, trehalose, izomaltose) and trisacchar- ides (erloze, melezitose). Thus, sufficient accuracy and pre- cision of the methods were demonstrated. 11.4. Application of the method The results on the content of the sugars analyzed by the HPLC-RID method, in multifloral pollen samples originating from Poland, South Korea and China are presented SzczeRsna, (2007) in Table 46 and show that the sugar con- tent of pollen dry matter averages 40%. The fructose ranged from 9.74 to 22.06DM, and the average was 15.94 g/100 g DM. The glucose content was lower by several g/100 g and ranged from 8.45 to 20.06 g/100 g; the average being 14.02 g/ 100 g DM. Of the tested disaccharides, saccharose occurred in the highest concentrations, ranging from 1.13 to 4.84 g/ 100 g DM; the average being 3.20 g/100 g DMmaltose fol- lowed ranging from 1.07 to 3.51 g/100 g DM; the average being 2.47 g/100 g DM. Those four sugars varied substantially within each of the samples. The variation was related to their botanical origin. In the majority of samples, the content of other such analyzed disaccharides as trehalose and tura- nose was at the detection limit of 0.2 g/100 g DM. Bobis et al. (2010), Martins et al. (2011), Margaoan et al. (2012) and Taha (2015) used the same method as SzczeRsna (2007) to quantify the sugar content of sugars and con- firmed the predominance of fructose followed by glucose in pollen samples (Table 48). Bobis et al. (2010) found fruc- tose and glucose to be on average at concentrations of 19.31 and 17.86 g/100 g, respectively. They investigated dis- accharides were in similar quantities as those investigated by SzczeRsna (2007). Martins et al. (2011) determined the fructose concentration to be ranged between12.59 and 23.62 g/100 g and the average 18.99 g/100 g, while the glu- cose concentration between 6.99 and 21.85 g/100 g and the average 14.89 g/100 g. According to Margaoan et al. (2012), fructose content ranged between 8.44 and 15.39 g/100 g, and glucose content – between 4.37 and 16.14 g/100 g. The results received by Taha (2015) for a few monofloral pol- lens (Cucurbita pepo Thunb, Phoenix dactylifera L., Helianthus annus L., Medicago sativa L., Brasica napus L.), showed that fructose content ranged from 17.13 g/100 g for rape (Brassica napus L.) pollen to 21.30 g/100 g for date palm pol- len (Phoenix dacttylifera L.), and glucose content from 15.44 g/100 g for sunflower (Helianthus annus L.) pollen to 17.06 g/100 g for date palm (Phoenix dacttylifera L.) pollen. With the above-described method, the Bee Products Quality Testing Laboratory, the Apiculture Division of the National Institute of Horticultural Research, Poland produced results for multifloral pollen samples were in the same range as the results received by the above- mentioned authors. Fructose content ranged between 15.40 and 22.54 g/100 g DM, 17.01 g/100 g DM, on aver- age. Glucose content ranged between 10.42 and18.54 g/ 100 g DM, 14.01 g/100 g DM, on average. Saccharose content ranged between 2.80 and 7.40 g/100 g DM, with an average value of 5.70 g/100 g DM. 12. Standard method for vitamin analysis in bee pollen 12.1. Introduction Bee pollen contains vitamins of B complex, vitamin C, E and carotenes with provitamin A function (alpha and beta- carotene) (Arruda et al., 2013a, 2013b; Melo et al., 2009; Melo & Almeida-Muradian, 2010; Oliveira et al., 2009; Sattler et al., 2015; Souza et al., 2018). Vitamins are classi- fied in terms of solubility. The lipid-soluble vitamins (vita- mins A, D, E and K) are a group of chemical substances with different structure which are soluble in organic sol- vents and are stored in the body fat, but can be toxic when consumed in excess. Water-soluble vitamins (vitamins B1, B2, B6, B12, folic acid, pantothenic acid, niacin, biotin and vitamin C) are not normally stored in significant amounts in the body, which leads to the need for a daily supply of these vitamins (Ball, 1998). Methods used to evaluate the vitamin content can be seen in Table 47. 12.2. B complex vitamins 12.2.1. Methods for B complex vitamins Before vitamin analysis, it is necessary to determine the moisture content, so the results can be expressed in dry basis. From the current methods for moisture determination in dried bee pollen samples, the drying out process with infrared light at 85 C and Standard methods for pollen research 71 lyophilization is recommended (Melo & Almeida- Muradian, 2010, 2011). The following procedures are based mainly in the on the work of Arruda et al. (2013a) and Arruda et al. (2013b) and Souza et al. (2018). 12.2.1.1. Simultaneous extraction of vitamins B1, B2, vitamers from vitamin B6 and niacin. For the simul- taneous extraction of B vitamins, it is used an acid hydrolysis followed by enzymatic treatment with fungal diastase like this: In an Erlenmeyer flask, approximately 5 g of dried bee pollen is mixed with 50ml of HCl 0.1mol/l and kept in boiling water bath for 30min. After cooling to room tem- perature, the solutions have their pH adjusted to 4.6 with sodium acetate 2.5M. After adding 0.5 g of the diastase (from fungi), the solutions are incubated for 2 h at 42 C in a water bath. After the enzymatic treatment and cool- ing at room temperature, the solutions are transferred to 100ml volumetric flasks; the volumes should be com- pleted with deionized water, homogenized and filtered through filter paper and in 0.45-mm membrane for injec- tion into the chromatographic system. 12.2.1.2. Chromatographic conditions for the analysis of the B complex vitamins in dried bee pollen. The chromatographic conditions vary for each vitamin. Vitamin B1 and B2 are analyzed under the same condi- tions, while vitamin B6 and PP are quantified in distinct conditions. Vitamins B2 and B6 are detected directly by fluorescence, while vitamins B1 and PP underwent pre- and post-column reaction, respectively, to be also detected by fluorescence. 12.2.1.3. Determination of thiamin (vitamin B1), with pre-column reaction. For the reaction of thiamin into thiochrome, 1ml of standard solution is diluted from the sample extract is pipetted into 10ml amber volu- metric flasks, 2ml of deionized water and 3ml of freshly prepared alkaline potassium ferricyanide solution, [0.25% (w/v) in 15% NaOH]. The mixture is homogen- ized and put to rest for 2min to allow the reaction. After this period, 450ml of 85% orthophosphoric acid is added. The solution is then cooled, and the final vol- ume is completed with deionized water. These solutions are filtered in a 0.45-mm membrane and injected into the chromatographic system immediately after prepar- ation. For the separation, 20ml is injected into a C18 reversed-phase column (RP-18 spherical 5 lmm/ 250 4.6mm) with pre-column (5 lm/10 4.6mm). The mobile phase is composed of phosphate buffer pH 7.2 (10mM KH2PO4.3H2O) and dimethylformamide (85:15); flow rate: 1ml/min and detection by fluores- cence (Ex 368 nm; Em 440 nm). 12.2.1.4. Determination of riboflavin (vitamin B2). 20ml is injected into C18 reversed-phase column (RP-18 spherical 5lm/250 4.6mm ) with pre-column lm/ 10 4.6mm). The mobile phase is composed of phos- phate buffer pH 7.2 (10mM KH2PO4.3H2O) and dime- thylformamide (85:15); flow rate of 1ml/min and detection by fluorescence (Ex 450 nm; Em 530 nm). 12.2.1.5. Determination of vitamin PP through niacin and niacinamide vitamers. Vitamin PP is detected by fluorescence after reaction under ultraviolet (UV). For the separation, 20ml is injected into C18 reversed-phase column (Luna C18, spherical 5 mm/250 4.6mm) with pre-column (5 mm/2 8mm). The mobile phase is com- posed of 0.07M potassium dihydrogen phosphate, KH2PO4 solution (pH 4.5) of phosphate buffer of 75mM hydrogen peroxide and 0.1% of 5mM copper sulfate solution; flow: 1.5ml/min; reactor composed of 12m of tetrafluoroethylene (TFE) tuve (0.5mm internal diameter, wrapped around a black lamp) that emits radi- ation from 300 to 400 nm; fluorescence detection (Ex 322 nm; Em 380 nm). 12.2.1.6. Determination of vitamin B6 through the vitamers pyridoxol, pyridoxal and pyridoxamine. For the separation, 20ml is injected into a C18 reversed- phase column (LiChrospher1 100 RP-18 end-capped 5mm/250 4.0mm), with pre-column (5 mm/4 4mm Lichrospher 100 RP-18). The mobile phase is composed of phosphate buffer pH 2.5 (39mM KH2PO4) with ion pair (0.63mM PIC 7) and acetonitrile (96:4); flow: 0.6ml/min; detection by fluorescence (Ex 296 nm; Em 390 nm). 12.3. Methods recommended to analyze antioxidant vitamins of bee pollen The following procedures are based mainly in the on the work of Melo and Almeida-Muradian (2010, 2011) and Sattler et al. (2013). 12.3.1. Determination of vitamin C The method is a titrimetric method, based on the reduction of 2,6-dichlorophenol-indophenol (DCPIP) by ascorbic acid (also recommended by AOAC, 1995). 12.3.2. Determination of vitamin E This vitamin is analyzed using high-performance liquid chromatography (HPLC) using silica column and fluores- cence detector (Ex. 295; Em. 330); mobile phase: hex- ane/isopropyl alcohol (99:1); flow rate: 1.5ml/min. 12.3.3. Determination of b-carotene (provitamin A) This carotenoid, as well as other carotenoids can be analyzed using both open column chromatography (OCC) (Almeida-Muradian et al., 2005; Oliveira et al., 2009) or HPLC, using C18 column (25 cm, 5 um), diode 72 M. G. Campos et al. array detection (450 nm); mobile phase: methanol, ethyl acetate, acetonitrile (70:20:10); flow rate: 1.2ml/min. 12.4. Concluding remarks Note that the dehydration process, which is favorable for the preservation of bee pollen and the increase of shelf life of the product, do not interfere in the content of complex B vitamins (p< 0.05). In general, it can be stated that the concentration of vitamins is dependent on storage time and not on the conditions in which the dry pollen is stored (p< 0.05). When stored at room temperature, vitamin C is rapidly lost, probably due to oscillations in temperature, and, after this initial sharp loss, it becomes quite stable during the storage process. In relation to vitamin E (Melo & Almeida-Muradian, 2010), the storage conditions do not account for drastic losses in its concentrations. 13. Standard methods for mineral and trace elements 13.1. Introduction Insufficient data are available on the different compos- ition and variability of minerals and trace elements in bee pollen between plant species. In each region, the collected bee pollen generally came from just a few spontaneous plant species and agricultural crops in each region play also an important role as pollen sources. Among the micronutrients vitamins, polyphenols and minerals are the more important for human well-being. Nevertheless, some minerals can be toxic if the intake is higher or over a long period, (e.g., Zn, Se, Mn and Mo). Others at excessive levels may exhibit high toxicity (Villanueva & Marquina, 2001; Serra-Bonvehı & Escola Jorda, 1997; Yang et al, (2014). According FAO (2001) the mineral elements can be classified as “nutritionally essential major elements” (e.g., Ca, Cl, K, Mg, N, Na, P and S), “nutritionally essential minor elements” (e.g., Fe, B, Br, I and Si) and those regarded as “toxic” at exces- sive levels and may exhibit toxicity (e.g., Zn, Se, Mn, Mo). Given the importance and variability of different minerals founded in bee pollen, Campos et al. (2008) proposed the inclusion in label of bee pollen, for sale, additional information related to different constituents and also minerals, to complement the label and improve the value of the product. 13.2. Materials and methods Usually the determination of mineral and trace elements on bee pollen is carried out on pollen ash, most fre- quently by atomic absorption. The main mineral is K (about 60% of total mineral content), Mg constitutes about 20%, and Na and Ca 10% (SzczeRsna & Rybak- Chmielewska, 1998). 13.2.1. Sample preparation According to the analytical method used, different sam- ple preparations methodologies can be performed. Method 1: for Flame and Electrothermal Atomic Absorption Spectrometry (Stanciu, Marghitas, Dezmirean and Campos, 2012). 1. weigh 2 g of pollen; 2. ash in a muffle furnace at 450 C overnight; 3. digest by treating with hydrochloric acid 6 M (5ml) and H2O2 (3ml) and then evaporate; 4. dissolve with 25ml nitric acid 0.1 M. A blank digest was also carried out; 5. Lanthanum nitrate [La(NO3)3x6H2O] were used as matrix modifier for the determination of potassium, calcium and magnesium. Method 2: for flame atomic absorption spectrometry and analyzing honey and pollen (Grembecka & Szefer, 2013): 1. weigh 1 g (±0.0001 g); 2. treat with 9ml 65% HNO3 and digest in an automatic microwave digestion system: 250 W, 48 s; 0 W, 48 s; 250W, 6min 24 s; 400 W, 4min; 650 W, 4min; 3. cycle consists of five food samples and one blank sam- ple (9ml 65% HNO3); 4. every digested sample is dissolved in up to 10ml deionized water. Method 3 (Loper et al., 1980): 1. weigh 1g of pollen; 2. digest with alternate aliquots of concentrated nitric acid and hydrogen peroxide; 3. boil and dry at 130 C until the residual ash will be white or light gray. Three cycles were sufficient; 4. taken up residues in dilute HCl and determine directly for Zn and Pb. For Mg, Ca and K analyses, samples are diluted 50–100 times to provide concentrations in the proper absorption range. Method 4: for Inductively coupled argon plasma-atomic emission spectrometry (ICP-AES): Paulo et al. (2012, 2014) 1. 200mg of dry bee pollen digest with a mixture of nitric acid (10% v/v) and hydrogen peroxide (30% v/v) at 100 C in a block digestion system (Digiprep MS) until complete digestion (12 h). 2. final residue is dilute to 50ml with nitric acid (10% v/ v) and filter. Method 5: Yang et al. (2014) 1. 1.0 g of digested bee pollen with 10ml of concentrate nitric acid (65%) and 1ml of hydrogen peroxide (30%) in a close polytetrafluoroethylene-stopper vessel for 8 h at 170 C. Standard methods for pollen research 73 13.2.2. Methods of analysis The methods that are usually used for mineral compos- ition determination in food products were the Flame and Electrothermal Atomic Absorption Spectrometry and the inductively coupled plasma atomic emission spectroscopy with or without mass detector. However, some easier methods could be use if only the determin- ation of calcium will be required. Kelina et al. (2013) determine the concentration of calcium in bee pollen samples from Lambayeque – Peru using complexometric method. In this method 0.1 g of ash were used to add- ing a few drops of hydrochloric acid, the results being expressed as percentage on dry basis. 13.2.2.1. Flame and electrothermal atomic absorption spectrometry. Flame and Electrothermal Atomic Absorption Spectrometry is a very common method of food mineral analyses applied mostly for the determin- ation of alkali and alkaline metals. Equipment (1) Device equipped with deuterium lamp for back- ground correction and hallow-cathode lamps for each of the elements studied and air/acetylene flame (Stanciu et al., 2011, 2012). (2) Flame atomic spectrometric measurements (F-AES/AAS) using the optimal instru- mental parameters for each element with the following wavelengths: 766.5 nm (K); 422.7 nm (Ca); 285.2 nm (Mg); 248.3 nm (Fe) and 213.9 nm (Zn). Good linearity for the method is observed and the calibration curves present a very good accuracy with an r2 ranged between 0.9990 and 0.9999. Grembecka and Szefer (2013) analyzed the concen- tration of elements (Mg, Ca, K, Na, Zn, Cu, Fe, Cr, Co, Ni, Mn, Pb and Cd) in pollen and honey in an air–acety- lene flame by AAS method using deuterium-background correction. These authors added Cs to samples, for Na and K determinations and standards as an ionization buffer at a concentration of 0.2%w/v. In the case of Ca and Mg measurements, La was used as a releasing agent at a concentration of 0.4%w/v. 13.2.2.2. Inductively coupled plasma atomic emission spectroscopy (ICP-AES) methods. Method I (Paulo et al., 2012, 2014): 1. All experiments were carried out using an inductively coupled plasma-optical emission spectrometry (ICP- OES- Activa M, Horiba Jobin Yvon), operating at 1000 W plasma power; 2. 15 l min1 plasma gas flow, 0.02 l min1 nebulizer Air flow and 1.0 bar air pressure; 3. The analytical wavelengths (nm) were set of the fol- lowing: Cd (228.802), Cr (205.571), Cu (327.395), Fe (259.940), Mn (257.611), Pb (283.305) and Zn (213.857); 4. Results expressed in mg.kg1 on a dry weight basis. Method II (Yang et al., 2014): 1. Plasma gas flow rate (Ar), 16 l.min1; 2. auxiliary flux, 1.0 l.min1; 3. nebulized pressure, 25 psi; sample flush time, 30 s; delay time, 30 s; solution uptake rate, 1.60ml.min1; 4. radio frequency, 27.12MHz; power, 1.05 kW; 5. absorbance data for each element recorded at the fol- lowing wavelengths: Al (k ¼ 308.2 nm), As (k ¼ 189.0 nm), Ca (k ¼ 317.9 nm), Cd (k ¼ 228.8 nm), Co (k ¼ 228.6 nm), Cr (k ¼ 283.5 nm), Cu (k ¼ 324.7 nm), Fe (k ¼ 259.9 nm), Ge (k ¼ 265.1 nm), Hg (k ¼ 184.9 nm), K (k ¼ 766.4 nm), Mg (k ¼ 279.5 nm), Mn (k ¼ 257.6 nm), Mo (k ¼ 202.0 nm), Na (k ¼ 589.5 nm), Ni (k ¼ 231.6 nm), P (k ¼213.6 nm), Pb (k ¼ 220.3 nm), Se (k ¼ 196.0 nm) and Zn (k ¼ 213.8 nm); 6. Results expressed in micrograms per gram on a dry weight basis. To be underlining that ICP-MS is a powerful, but expensive technique for determination of trace mineral. It is also used for other bee products too as honey, for example Caroli et al. (1999), Madejczyk and Baralkiewicz (2008) and Chudzinska and Baralkiewicz (2011). 13.3. Concluding remarks Some preliminary results from the composition of min- erals in bee pollen can give a good idea of the amounts and the identification of the main of these compounds on this crude material. Still the information remains scarce relatively to different floral sources and in special correlating minerals and regions of the globe. The coun- tries should do similar assays to collect the most data possible to validate the amounts and the contaminants as this content could be a bio-indicator of the environ- mental condition or pollutants. The amount of minerals in bee pollen from the vari- ous data collected in the published papers can be found in Table 49. Stanciu et al. (2012) analyzed pollen loads samples obtained by pollen traps installed in Apis melli- fera (L.) hives located in the northwest and central counties of Transylvania area (Romania). These authors confirmed that the examined bee pollen is a natural source of nutritionally essential minerals and can con- tribute for a better balanced diet or for special thera- peutic applications. In their work, the authors reported that the main macro elements were potassium (2483–7620mg/kg), calcium (553–2798mg/kg) and mag- nesium (3555–205mg/kg), while the main microele- ments were iron (18.8–135mg/kg) and zinc 18.8–60.5mg.kg1. Variations in the mineral levels of the analyzed monofloral bee pollens were due to differ- ences in the floral origin. Loper et al. (1980) use similar methodology, with flame absorption spectrometry for mineral 74 M. G. Campos et al. determination (e.g., Mg, Ca, K, Zn and Pb) in fresh pol- len collected by hand from flowers, bee pollen removed from the bees’ legs and collected from the pollen traps from California. Potassium is the main compound in bee pollen. Highest values of potassium were reported by Stanciu et al. (2011) in Salix sp. pollen (8686mg/kg), in Helianthus annuus L. pollen (5421mg/kg) and by Stanciu et al. (2012) in Knautia arvensis (L.) (7619.57mg/kg), in Onobrychis viciifolia Scop. (6748.72mg/kg), Crataegus monogyna Jacq. (6224.17mg/kg) and Inula helenium L. (6078.28mg/kg), Taraxacum officinale Web. (2483.51mg/ kg), Carduus sp. (3865.27mg/kg) and among others pol- len samples analyzed. Different authors reported different values for pollen potassium concentration, namely: 4000mg/kg (Villanueva & Marquina, 2001), 5530mg/kg (Somerville & Nicol, 2002), 2843–5976mg/kg (SzczeRsna, 2007) and 4950–5131mg/kg (Salamanca et al., 2008) (Table 49). These results confirm the higher variability of pollen mineral composition related to the different origin of pollen. Calcium followed by magnesium were the next highest mineral content in pollen. All authors founded significant differences related to the higher concentra- tion of potassium compared with the other minerals. Yang et al. (2014) analyzed twelve common varieties of monofloral bee pollen collected from China’s main pro- ducing regions. On average the values obtained were the following: P 5946mg/kg, K 5324mg/kg, Ca 2068mg/ kg, Mg 1449mg/kg, sodium 483mg/kg, aluminum 129mg/kg, iron 119mg/kg, magnesium 70mg/kg, zinc 45mg/kg and cupper 17mg/kg. Paulo et al. (2012) analyzing Cistus ladanifer L., Rubus ulmifolius Schott and Calluna vulgaris (L.) found different composition of micronutrients (Cu, Fe, Mn and Zn) in pollen related to different botanical origins but not from the same species in different region. These authors concluded that the determination of micronu- trients could be suitable for the identification of botan- ical species. The contents of Cd, Pb, As and Hg were usually lower or not detected in pollen samples. In Campos et al. (2008), the limits for this trace elements were Cd  0.1mg/kg, Pb  0.5mg/kg, As  0.5mg/kg and Hg  0.03mg/kg. 14. Standard methods for pyrrolizidine alkaloid profiling by UHPLC-HRMS 14.1. Introduction Pyrrolizidine alkaloids (PAs) are secondary metabolites produced by some plants as defense mechanism against herbivores and phytophagous insects. They can occur as N-oxides or free-bases/tertiary PAs. In plants, the N- oxides are often found in higher concentrations as com- pared to the corresponding free-bases/tertiary PAs (Hartmann & Toppel, 1987; Hartmann & Witte, 1995). PA containing plant species mainly belong to the families of Boraginaceae (all genera), Asteraceae (mainly genera of Senecioneae and Eupatorieae), Fabaceae (mainly genus of Crotalaria) and Apocynaceae (Hartmann & Witte, 1995). PAs can get into bee products, such as honey and pollen, when bees collect nectar or pollen of PA containing plants. PAs have been detected in plant pollen (Boppre et al., 2005; Kempf et al., 2010). High concentrations of PAs have also previously been reported in bee collected pollen (D€ubecke et al., 2011; Kempf et al., 2010) presenting a food safety concern for the consumers of pollen as a nutritional supplement. PAs are classified as esters of hydroxylated methyl pyr- rolizidines, consisting of a necine base (1,2-saturated or unsaturated) and one or more necinic acids (Hartmann & Witte, 1995) (Figure 47a,b). Esters of 1,2 unsaturated retronecine- and otonecine type PAs are toxic for humans and animals (Prakash et al., 1999; R€osemann et al., 2014). The structural diversity of more than 400 known PAs (Boppre, 2011; Kempf et al., 2011) repre- sents an analytical challenge and no standardized method has been established so far to determine the PA content in bee products. Many PAs are difficult to quantify, due to the lack of standard materials. Two main analytical approaches are commonly used: a sum parameter GC-MS method (Kempf et al., 2008, 2010, 2011) and a targeted LC-MS method allowing the individual identification of PAs and PA-N-oxides (Betteridge et al., 2005; Boppre et al., 2005; Kempf et al., 2011). The GC-MS method covers most PAs, except the otonecine-type PAs, but derivatization is required and structural information of the original PAs is lost. On the other hand, the targeted LC-MS method identifies individual PAs, but unknown PAs are not detected and the chromatographic separation of many PA isomers is also not easily obtained. To at least par- tially overcome these limitations, ultra-high pressure liquid chromatography coupled to high resolution mass spectrometry (UHPLC-HRMS) as a way to profile both known and unknown PAs can be used (Avula et al., 2015). Compared to conventional HPLC, UHPLC ena- bles a more rapid separation with higher resolution and is more efficient at separating closely related molecules, e.g., positional isomers (Plumb et al., 2004). UHPLC relies on the use of smaller particles (sub-2mm) and instrumentations able to resist higher pressure, typically up to 1000 or 1500 bars. HRMS systems, such as time- of-flights (TOF) or electrostatic trap (OrbitrapTM) rep- resent an attractive way to record data from UHPLC separation at high frequency and in a non-targeted man- ner. HRMS measures ions with high mass and spectral accuracies and allows for the determination of elemen- tal compositions, which in turn may assist the identifica- tion of unknowns. Furthermore, recent instruments are fully compatible with quantitative or semi-quantitative analysis (Rochat, 2012). Here we describe a UHPLC- HRMS-based method for the profiling of PAs in plant pollen from Echium and Eupatorium species, which may be applied to other plant genera with minor adaptation. Standard methods for pollen research 75 14.2. Materials and methods 14.2.1. Equipment and chemicals a. Steel-made forceps from A. Dumont (#0208-55-PO) b. 1.5ml and 2ml tubes from Eppendorf (#0030120086, #0030120094) c. 2ml glass LC-MS tubes (screw top) from Kinesis (#KVP6112) d. polystyrene Petri dishes (Ø 10 cm) from Greiner (#663102) e. glass beads (Ø 2mm) from Sigma-Aldrich f. nitrile gloves (powder free) from Kimberly- Clark (#52003M) g. Solvents: cyclohexane SupraSolv (#102817), methanol SupraSolv (#106011) and formic acid for Analysis Emsure (#100264) from Merck, Acetonitrile ULC/MS (#012041) and Water ULC/MS (#232141) from Biosolve h. Standards: echimidine (CAS #520-68-3) and lycops- amine (CAS #10285-07-1) from Phytolab (#89553, #89726). 14.2.2. Collection of plant pollen from PA-containing plants Two examples: collection of pollen from E. vulgare (Boraginaceae) and from E. cannabinum (Asteraceae). 14.2.2.1. Pollen collection from E. vulgare. Plant pollen from E. vulgare, located as blue/violet dust on the anthers of the flower can be collected using steel-made surgery forceps or using pure cyclohexane (Figure 48a,b and Figure 49). Rainy days are not recommended for collec- tion, since pollen can be washed out from the anthers. 1. Verify that most of the flowers are well developed and fully open. 2. Tightly bag the plants on the field with fine mesh nets to avoid the pollen harvest from insects (at least one day before the collection). 3. Spread a layer of paraffin around the lower part of the stem to avoid that non-flying insects are climbing the plant to collect pollen. 4. Plant pollen can be collected two days after bagging the plant and is stored at 20 C until extraction. It is suggested to bring a cooler box container filled with dry ice on the field in order to place the freshly col- lected samples immediately on dry ice. 14.2.2.1.1. Collection with forceps. 1. Wear nitrile gloves during the collection. 2. Using forceps, scratch the pollen from the surface of the anthers of the flowers, carefully avoiding PA con- tamination by the stamen tissues. 3. Collect the pollen using pre-weighed 1.5ml tubes. Collect 1mg of pollen in each tube. 4. Insert the forceps carefully inside the tube and release the pollen on the walls of the vial. Try to avoid any electrostatic charge of the tube that could comprom- ise the collection. 14.2.2.1.2. Collection with cyclohexane. 1. Remove the stamens from the flower. 2. Immerge the stamens in a pre-weighed LC-MS glass tube containing cyclohexane. 3. Shake the stamens delicately into the cyclohexane to release the pollen. 4. If possible, bring the tubes back to the laboratory to evaporate the cyclohexane under laminar-flow hood. Determine the weight of the dry pollen. 5. Store the dry pollen at 80 C until extraction. Pros: This technique allows a faster collection of pollen when compared to the method by forceps. Both collec- tion methods give similar concentrations of PAs as we have determined in our laboratory. 14.2.3. Pollen collection from E. cannabinum Plant pollen from E. cannabinum (Figures 50 and 51), located along the stamens, can’t be collected using for- ceps due to the small dimensions of the tubular floral units (approximately 7mm). Figure 48. (a and b) Structure of a flower of E. vulgare. 76 M. G. Campos et al. Collection on Petri dishes 1. Bag the plant and apply the paraffin layer on the lower part of E. cannabinum. 2. After two days, shake the entire floral head of E. can- nabinum over a Petri dish in order to collect the pol- len that is released by this procedure. 3. Remove the impurities from the dish using forceps. 4. Collect the pollen into a pre-weighted 1.5ml tube. 5. Store the tube at 80 C until extraction. Pros: This method allows to collect rapidly a high amount of pollen from E. cannabinum. 14.3. Extraction of PAs from plant pollen PAs are polar organic compounds with basic character- istics. They are soluble in polar organic solvents or in mixtures of solvents and acidified water. 1. Transfer 1mg of plant pollen in a pre-weighed 2ml microcentrifuge tube using a metal spatula. 2. Dissolve the pollen in 100 ml of extraction solvent consisting of 70% methanol, 29.5% ultra-pure water and 0.5% formic acid. 3. Add 4–8 glass beads to the tube. 4. Shake the tube at 30.0Hz for 4minutes. 5. Centrifuge the tube at 18,407 g for 4minutes. 6. Collect the supernatant (extract) in a new tube. 7. Transfer with a pipette 5 ml of the extract and dilute 5–20 times with the extraction solvent into a glass LC-MS vial containing a conical glass insert. Pros: This technique can be used for extracting plant pollen from many plant genera. 14.4. Profiling of PAs in plant pollen with UHPLC-HRMS Non-targeted analysis using LC-HR-MS system allows the detection of alkaloids found in Echium vulgare (echi- midine/-N-oxide, vulgarine/-N-oxide, acetyl-echimidine/- N-oxide, acetylvulgarine/-N-oxide and echivulgarine/-N- oxide) and alkaloids found in Eupatorium cannabinum (intermedine/-N-oxide, lycopsamine/-N-oxide). Separation of the alkaloids is performed using an Acquity UPLC (Waters). The UPLC system is coupled to a Synapt G2 QTOF mass spectrometer (Waters). An Acquity BEH C18 column (50 2.1mm i.d., 1.7 mm par- ticle size, Waters) fitted with guard column (5 2.1mm) of identical phase is utilized. The column is maintained at 30 C and a binary gradient of separation Figure 49. An E. vulgare plant bagged with a net and supported by a metal structure. Figure 50. Structure of a floret and a floral head of E. cannabinum. Standard methods for pollen research 77 is performed at flow rate of 0.4ml min1. The mobile phase consists of 0.05% formic acid in water (solvent A) and 0.05% formic acid in acetonitrile (solvent B). The gradient program used is: 0–4min 5–40% B, 4–6min 40–100% B, 6–9min 100% B, 9.1–10.5min 5% B. Injection volume is 1ml. The autosampler needle is washed with methanol/acetonitrile/isopropanol (1:1:1) followed by 0.05% formic acid in water between injec- tions to eliminate carryover. The QTOF operates in electrospray positive mode over a mass range of 50–600Da. MS conditions are: Capillary voltage þ2800V, cone voltage þ30 V, source temperature 120 C, desolvation gas temperature and flow 350 C and 800 l/h, respectively, scan time 0.4 s. A leucine-enke- phaline solution at 400 ng/ml is infused throughout the analysis to ensure high mass accuracy (<2 ppm). Fragmentation spectra are recorded in separate analyses in MSe mode using a collision energy ramp of 10–30 eV. Data are recorded using Masslynx 4.1 and PAs are iden- tified on the basis of their retention times, exact mass fragmentation characteristics and comparison with the existing literature and databases containing information on PAs known in Echium and Eupatorium genus. External calibration for the quantification of the PAs is made using echimidine, intermedine and lycopsamine as stand- ards. Five calibration points are made: 0.02, 0.1, 0.5, 2, and 10 mg/ml. Linear responses are obtained from 0.02 to 2mg/ml (Table 48). The limit of detection (LOD) and limit of quantitation (LOQ) for echimidine, lycopsamine and intermedine are 1.5 ng/ml and 3 ng/ml, respectively. As only a limited number of reference standards are available, a number of other PAs and PA-N-oxides com- monly found in Echium (echimidine-N-oxide, vulgarine/- N-oxide, acetyl-echimidine/-N-oxide, acetylvulgarine/-N- oxide, echivulgarine/-N-oxide) are indirectly quantified as echimidine equivalents. PAs and their PA-N-oxides and isomers in pollen of E. vulgare and E. cannabinum determined with LC-MS analysis are reported in Table 49. Two examples of extracted ion chromato- grams of PAs are shown in Figure 52. Pollen samples of E. vulgare and E. cannabinum ana- lyzed contain mainly PA-N-oxides while free bases were only present as traces. Table 50 shows the MS/MS frag- ments of PA-N-oxides detected in pollen samples. In addition, PAs not previously reported to be present in pollen of E. vulgare and E. cannabinum can also be detected by UHPLC-HRMS. They are tentatively identi- fied through the determination of their molecular for- mula based on high mass and spectral accuracy measurements by the high resolution QTOF mass spec- trometer (Table 51). 14.5. Data processing The following procedure is used for the detection and quantification of PAs. Provided that the identity of the PA is known, this procedure may also be applied to other types of alkaloids from other plant species. 1. To identify the different alkaloids, generate an extracted ion chromatogram (EIC) using a mass win- dow of ± 0.01Da around the values provided in Table 49. 2. Verify the mass accuracy of the ions compared to the theoretical values. 3. In the EICs integrate the peaks and calculate concen- trations in ng/g or mg/g of pollen using your ownFigure 51. An E. cannabinum plant bagged with a net. Table 51. PAs which have not been previously reported from E. vulgare and E. cannabinum. Compound name RT (min) Chemical formula [MþH]þ experimental [MþH]þ calculated Error (mDa)  Echium vulgare Curassavine-N-oxide 1.54 C16H29NO5 316.2125 316.2124 0.1  Eupatorium cannabinum Leptantine 1.41 C15H27NO6 318.1922 318.1917 0.5 Amabiline 1.48 C15H25NO4 284.1865 284.1862 0.3 Uplandicine 1.71 C17H27NO7 358.1868 358.1866 0.2 Tentative identification. 78 M. G. Campos et al. calibration curves. Examples of equations are provided in Table 48. In this study we obtained a total PA concentration of 7.43 (± 2.45) mg/g in pollen of E. vulgare and 5.32 (± 1.98) mg/g in pollen of E. cannabinum. Pollen samples were collected in Switzerland in 2013. 14.6. Concluding remarks Liquid chromatography approaches are frequently chosen for the identification and quantification of PAs in plants and for food analysis, allowing the determination of individual PAs and PA-N-oxides. This is particularly important for determining the exact type of PAs which are present in a given plant species and also in food analysis, where the spectrum of PAs may help deduce the plant species that contribute to PA contamination. Additionally, the sample preparation is faster and does not need derivatization as required for gas chromatog- raphy analysis. However, many types of PAs are still not available on the market as reference substances. Therefore, a number of PAs are quantified using a refer- ence substance that is closely related but not identical to the analyzed PAs. Hence, quantification may not be entirely accurate, since the response factor of the Table 53. Statistics of the 134 sample of bee pollen analyzed. Parameter Mean ± r Minmax Coefficient of variation Total phenolic compounds 23.9 ± 4.16 16.1–35.5 17.4 Total flavonoids 4.1 ± 0.96 2.2–5.9 23.2 EC50 3.5 ± 1.05 2.0–6.4 39.1 ABTS 244.9 ± 24.40 203.8–298.6 10.0 Table 54. Results for calibration and cross-validation. Calibration Parameter Spectral range (cm1) Pre-processing Rk r2 RMSEE RPD Total phenolic compounds 2787 2459þ 2135 1809 2ndDer 8 92.6 1.16 3.7 Total flavonoids 2858 2509þ 2164 1470þ 777 430 VecNor 9 85.9 0.373 2.7 EC50 3055 2731þ 2087 1119þ 799 474 VecNor 10 89.7 0.351 3.1 ABTS 2557 1838þ 1479 399 1stDer 10 91.3 7.57 3.4 Cross-validation Parameter Spectral range(cm21) Pre-processing Bias r2 RMSECV RPD Total phenolic compounds 2787 2459þ 2135 1809 2ndDer 0.0044 79.3 1.88 2.2 Total flavonoids 2858 2509þ 2164 1470þ 777 430 VecNor 0.0020 76.0 0.469 2.0 EC50 3055 2731þ 2087 1119þ 799 474 VecNor 0.0185 77.9 0.492 2.1 ABTS 2557 1838þ 1479 399 1stDer 0.2470 72.5 12.7 1.9 2ndDer – seconded derivative; VecNor – vector normalization; 1stDer – first derivative; r2 – coefficient of determination; Rk – number of PLS components; RMSEE – root mean square error of calibration; RPD – residual prediction deviation; Bias – mean value of deviation, also called sys- tematic error; RMSECV – root mean square error of cross-validation. Table 52. Frequency of each plant genus as predominant pollen, secondary pollen, important minor pollen and minor pollen in the 134 pollen samples mixture analyzed. Genus Predominant pollen (>45%) Secondary pollen (15–45%) Important minor pollen (3–15%) Minor pollen (<3%) Eucalyptus spp. 13 21 21 21 Prunus spp. 8 4 4 4 Rubus spp. 8 11 8 8 Castanea spp. 15 34 23 8 Trifolium spp. 0 6 11 19 Cistus spp. 53 17 6 4 Echium spp. 21 17 11 4 Kiwi spp. 2 0 4 11 Leontondon spp. 0 2 17 11 Quercus spp. 0 6 11 15 Erica spp. 2 4 6 2 Thymus spp. 2 0 11 2 Genista spp. 0 6 6 2 Lavandula spp. 0 4 13 0 Cytisus spp. 11 23 11 2 Standard methods for pollen research 79 detector may differ between PAs, even when they are closely related to each other. Furthermore, positional isomers, such as lycopsamine and intermedine, are also not easy to separate. Finally, while some plant species have been relatively well characterized regarding their PA content (e.g., E. vulgare), little is known for many other PA-producing plant species. Recently, ultra-high performance liquid chromatography coupled with high resolution mass spectrometry has been described as a selective and sensitive method for the analysis of PAs in plants (Avula et al., 2015; Crews et al., 2009, 2010; Xiong et al., 2009). This method provides an accurate mass information based on which unknown PAs may also be detected in an untargeted manner without the need for reference standards for each PA, as has been shown in the present study. In the future we anticipate that UHPLC-HRMS will become the method of choice for the profiling of both known and unknown PAs in plants. 15. Standard methods for total phenolic compounds, total flavonoids and antioxidative capacity bee pollen evaluation by FTIR-ATR spectroscopy 15.1. Introduction FTIR-ATR techniques have been applied in several dif- ferent crud materials in order to simplify the analysis and have results quickly. Gok et al. (2015) used FTIR- ATR spectroscopy in automated and highly sensitive botanical origin estimation of honey. According Anjos et al. (2017) FTIR-ATR spectroscopy technique in com- bination with partial least squares regression (PLS-R) can be used to evaluate the ability to quantify total phenolic compounds, total flavonoids, free radical scav- enging (EC50) and antioxidant capacity (ABTS) in bee pollen. The method described in this chapter is based in this previously paper was PLS-Regression analysis was used to predicted for total phenolic compounds, total flavonoids, EC50 and ABTS. The calibrations model founded present a good accuracy for total phenolic compounds (r2 ¼ 92.6%; RPD ¼ 3.7), total flavonoids (r2 ¼ 85.9%; RPD ¼ 2.7); EC50 (r2 ¼ 89.7%; RPD ¼ 3.1) and ABTS (r2 ¼ 91.3%; RPD ¼ 3.4) of bee pollen). Figure 52. Extracted ion chromatograms of PAs identified in plant pollen of E. vulgare (A) and E. cannabinum (B). Peak numbers cor- respond to the PAs described in Table 51 (1: echimidine-N-oxide; 2: vulgarine-N-oxide; 3: acetylechimidine-N-oxide; 4: acetylvulgar- ine-N-oxide; 5: echivulgarine-N-oxide; 6: lycopsamine; 7: intermedine; 8-9: lycopsamine-N-oxide or intermedine-N-oxide). Figure 53. (a–d) Scheme of sample preparation for analysis in FTIR-ATR equipment. 80 M. G. Campos et al. T ab le 55 . C on di tio n va ri at io ns of th e D PP H  a ss ay on be e po lle n ac co rd in g to di ffe re nt au th or s. N um be r of re po rt R ef er en ce In iti al D PP H  c on ce nt ra tio n R ea ct io n tim e Ex pr es si on of ac tiv ity D PP H  v ol um e/ ex tr ac t vo lu m e 1 C am po s et al .( 19 97 ) 5. 91 m g/ 25 0 m li n et ha no l 10 m in EC 50 2. 5 m l-D PP H  s ol ut io n þ 1 to 10 ml ex tr ac t 2 K ro ye r an d H eg ed us (2 00 1) 6 10  5 M in m et ha no l 60 m in % in hi bi tio n 2. 7 m l-D PP H  s ol ut io n þ 0. 3 m le xt ra ct 3 N ag ai et al .( 20 02 ) 1 m M N I % ac tiv ity 0. 3 m l-D PP H  s ol ut io n þ 2. 4 m le th an ol þ 0. 3 m le xt ra ct 4 C am po s et al .( 20 03 ) 6 10  5 M in m et ha no l 10 m in EC 50 2 m l-D PP H  s ol ut io n þ ap pr op ri at e am ou nt of ex tr ac t 5 A lm ar az -A ba rc a et al .( 20 04 ) 3. 4 mg /m li n 50 % et an ol (v /v ) 10 m in EC 50 16 00 to 19 90 ml -D PP H  s ol ut io n þ 10 to 40 0 ml ex tr ac t. Fi na lv ol um e: 2 m l 6 N ag ai et al .( 20 05 ) 1 m M N I % ac tiv ity 0. 3 m l-D PP H  s ol ut io n þ 2. 4 m le ta no lþ 0. 3 m le xt ra ct 7 Si lv a et al .( 20 06 ) 6 10  5 M in et ha no l 30 m in EC 50 2 m l-D PP H  s ol ut io n þ ap pr op ri at e am ou nt of ex tr ac t 8 Le ja et al .( 20 07 ) 0. 1 m M in et ha no l 30 m in % in hi bi tio n 0. 08 3% po lle n in th e re ac tio n m ix tu re 9 Ba ltr u s ai ty t_ e et al .( 20 07 ) 6. 5 10  5 M in m et ha no l 16 m in % in hi bi tio n 2 m l-D PP H  s ol ut io n þ 50 ml ex tr ac t 10 C ar pe s et al .( 20 08 ) 0. 5 m M in et ha no l 10 0 m in % in hi bi tio n, EC 50 0. 3 m l-D PP H  s ol ut io n þ 3 m le th an ol þ 0. 5 m le xt ra ct 11 Si lv a et al .( 20 09 ) 10 0 mM in et ha no l 30 m in EC 50 2 m l-D PP H  s ol ut io n þ ap pr op ri at e am ou nt of ex tr ac t 12 Le Bl an c et al .( 20 09 ) 51 m g/ 10 0 m li n m et ha no l 60 m in % ac tiv ity ,E C 50 24 2. 5 ml D PP H  s ol ut io n þ 28 0 ml et ha no lþ 72 ml ex tr ac t 13 Le e et al .( 20 09 ) 10 m M 10 m in % sc av en gi ng ef fe ct 1 m l-D PP H  s ol ut io n þ 4 m le xt ra ct 14 M  ar gh ita s et al .( 20 09 ) 0. 02 m g/ m l 15 m in % in hi bi tio n 20 0 ml -D PP H  s ol ut io n þ 40 ml ex tr ac t 15 W an g et al .( 20 10 ) 0. 5 m M in et ha no l 30 m in % ac tiv ity 0. 5 m l-D PP H  s ol ut io n þ 0. 5 m la ce ta te bu ffe r (1 00 m M , pH 5. 5) þ 0. 5 m le xt ra ct 16 M en ez es et al .( 20 10 ) 0. 5 m M in et ha no l 30 m in % ac tiv ity 4 m l-D PP H  s ol ut io n þ 10 0 ml ex tr ac t 17 M or ai s et al .( 20 11 ) 6 10  5 M in m et ha no l 60 m in % -D PP H  d is co lo ra tio n, EC 50 2. 7 m l-D PP H  s ol ut io n þ 30 0 ml ex tr ac t 18 N eg ri et al .( 20 11 ) 20 mg /m li n m et ha no l 20 m in % ac tiv ity 3. 9 m l-D PP H  s ol ut io n þ 0. 1 m le xt ra ct 19 G ra ik ou et al .( 20 11 ) 70 mM in m et ha no l U nt il a pl at ea u w as re ac he d % ac tiv ity ,E C 50 1 m l-D PP H  s ol ut io n þ 50 ml ex tr ac t 20 Fe  as et al .( 20 12 ) 6 10  5 M in m et ha no l 60 m in % ab so rb an ce ,E C 50 2. 7 m l-D PP H  s ol ut io n þ 0. 3 m le xt ra ct 21 C ha nt ar ud ee et al .( 20 12 ) 0. 15 m M in m et ha no l 60 m in % ac tiv ity ,E C 50 50 ml -D PP H  s ol ut io n þ 50 ml ex tr ac t 22 M ej ıa s an d M on te ne gr o (2 01 2) 0. 02 m g/ m L in m et ha no l N I mg as co rb ic ac id eq ui va le nt s/ g sa m pl e 1. 5 m l-D PP H  s ol ut io n þ 75 0 ml ex tr ac t 23 M el o et al .( 20 12 a) N I N I % ac tiv ity N I 24 M el o et al .( 20 12 b) N I N I % ac tiv ity N I 25 M el o et al .( 20 12 c) N I 30 m in % in hi bi tio n N I 26 M el o et al .( 20 12 d) N I 30 m in % in hi bi tio n N I 29 A rr ud a (2 01 3) 6 10  5 M in et ha no l 30 m in EC 50 1. 5 m l-D PP H  s ol ut io n þ 2. 0 m le ta no lþ 0. 5 m le xt ra ct A rr ud a et al .( 20 13 ) N I N I EC 50 N I 27 M on te ne gr o et al .( 20 13 ) 0. 02 m g/ m l 15 m in mg as co rb ic ac id eq ui va le nt s/ g po lle n 1. 5 m l-D PP H  s ol ut io n þ 0. 75 m le xt ra ct 28 C he ng et al .( 20 13 ) 0. 1 m M in m et ha no l 30 m in % in hi bi tio n 4 m l-D PP H  s ol ut io n þ va ri ab le vo lu m es of ex tr ac t. Fi na lv ol um e: 10 m l 30 U lu so y an d K ol ay li (2 01 4) 0. 1 m M in m et ha no l 50 m in SC 50 1. 5 m l-D PP H  s ol ut io n þ 1. 5 m le xt ra ct 31 M el o et al .( 20 13 ) N I 30 m in IC 50 N I 32 Ba rr ia da -B er na le t al .( 20 14 ) 40 mg /m li n et ha no l 30 m in EC 50 60 0 to 99 0 ml -D PP H  s ol ut io n þ 10 to 40 0 ml ex tr ac t. Fi na lv ol um e: 1 m N I¼ N ot in di ca te d. Standard methods for pollen research 81 T ab le 56 . A dv an ta ge s an d di sa dv an ta ge s of so m e te ch ni qu es an d m et ho ds us ed fo r an ti- m ic ro bi al an al ys is . M et ho ds A dv an ta ge s D is ad va nt ag es R ef er en ce s A ga r D iff us io n  T he te ch ni qu e w or ks w el lw ith de fin ed in hi bi to rs ; Fl ex ib ili ty in se le ct io n of di sk s fo r te st in g; It s si m pl ic ity of im pl em en ta tio n an d it is th e le as t co st ly of al ls us ce pt ib ili ty m et ho ds ; Fo r te st in g of an tif un ga ls us ce pt ib ili ty its re la tiv e ea se ; D oe s no t re qu ir e fo r sp ec ia liz ed eq ui pm en t; H as in tr in si c fle xi bi lit y by be in g ab le to te st th e dr ug s th e la bo ra to ry ch oo se s; T he pr ov is io n of ca te go ri ca lr es ul ts ea si ly in te rp re te d by al lc lin ic ia ns ; T he di sk te st ha s be en st an da rd iz ed fo r te st in g no t al lf as tid io us or sl ow gr ow in g ba ct er ia bu t, fo r so m e as st re pt oc oc ci , H ae m op hi lu s in flu en za e, an d N .m en in gi tid es .  Le ss se ns iti ve th an m ic ro -d ilu tio n te ch ni qu es ; R eq ui re s m uc h qu an tit y of sa m pl e fo r an al ys is ; T he an tim ic ro bi al ef fe ct m ay be in hi bi te d or in cr ea se d by ex tr in si c fa ct or s or co nt am in an ts as th e ty pe of ag ar an d hi s co nc en tr at io n, sa lt co nc en tr at io n, in cu ba tio n te m pe ra tu re ,a nd m ol ec ul ar si ze of th e an tim ic ro bi al co m po ne nt ; T he re ar e su bs ta nc es in th e cu ltu re m ed iu m th at in flu en ce th e te st su sc ep tib ili ty as th ym id in e th at an ta go ni ze s th e ac tiv ity of su lfo na m id es an d tr im et ro pr in as ,l ea di ng to a fa ls e re su lt of re si st an ce to su ch ag en ts ; T hi s te ch ni qu e al so do es no t di st in gu is h be tw ee n ba ct er ic id al an d ba ct er io st at ic ef fe ct s; T he pH of th e cu ltu re m ed iu m sh ou ld be co m pa tib le w ith th e m ic ro bi al gr ow th be ca us e th e in cr ea se in ac id ity of th e m ed iu m de cr ea se s th e an tib ac te ri al ac tiv ity .B y an ot he r si de ,i nc re as es th e ac tiv ity of ac id ic su bs ta nc es su ch as pe ni ci lli n; T he m in im um in hi bi to ry co nc en tr at io n (M IC ) ca nn ot be de te rm in ed ; Is di ffi cu lt to ex am in e th e su sc ep tib ili ty of fa st id io us an d sl ow -g ro w in g ba ct er ia ; It is la bo r- in te ns iv e an d tim e- co ns um in g; C an re pr es en t an ex pe ns iv e ap pr oa ch if m or e th an a fe w dr ug s ar e te st ed ; T he la ck of m ec ha ni za tio n or au to m at io n of th e te st . H ew itt an d V in ce nt (1 98 9) ;M ar sh an d G oo de (1 99 4) ;E lo ff (1 99 8) ;S co rz on ie t al .( 20 07 ); R ex et al .( 20 01 ); O st ro sk y et al .( 20 08 ); Ba rr y an d T ho rn sb er ry (1 99 1) ;K la nc ni k et al .( 20 10 ); W ilk in s an d T hi el (1 97 3) ;J ia ng (2 01 1) ; Jo rg en se n an d Fe rr ar o (2 00 9) . M ac ro di lu tio n -G en er at io n of a qu an tit at iv e re su lt (i. e. ,t he M IC ); -E as e of pe rf or m an ce ; -E co no m y; -M or e ra pi d re su lts ,t he re fo re th ei r de ve lo pm en t co ul d be hi gh ly de si ra bl e.  R eq ui re s la rg e vo lu m es of an tib io tic ; It is no t re co m m en d us in g fo r m os t ro ut in e pr oc ed ur es ; T im e co ns um in g; It is te di ou s; M an ua lt as k of pr ep ar in g th e an tib io tic so lu tio ns fo r ea ch te st ; T he po ss ib ili ty of er ro rs in pr ep ar at io n of th e an tib io tic so lu tio ns ; R el at iv el y la rg e am ou nt of re ag en ts an d sp ac e; G en er at e la rg e am ou nt s of w as te . Jo rg en se n an d Fe rr ar o (2 00 9) ;C LS I (2 00 8) ; W ie ga nd et al .( 20 08 ); O st ro sk y et al .( 20 08 ). M ic ro -d ilu tio n in m icr ot ite r pl at e (9 6 w el ls)  T he m et ho d is ro bu st ,i s no t ex pe ns iv e; G iv es re pr od uc ib le re su lts an d co nv en ie nc e of ha vi ng pr e- pr ep ar ed pa ne ls ;  T he la ck of or po or gr ow th of m an y an ae ro bi c m ic ro or ga ni sm s; T es tin g so m e fa st id io us an ae ro be s gi ve s El of f (1 99 8) ;O st ro sk y et al .( 20 08 ); C lin ic al an d La bo ra to ry St an da rd s In st itu te (C LS I) (2 00 9) ; Jia ng (2 01 1) ;J or ge ns en an d Fe rr ar o (2 00 9) . (C on tin ue d) 82 M. G. Campos et al. T ab le 56 . (C on tin ue d) . M et ho ds A dv an ta ge s D is ad va nt ag es R ef er en ce s Is ca .3 2 tim es m or e se ns iti ve th an ot he r m et ho ds us ed in th e lit er at ur e; R eq ui re s a sm al l/m in im al qu an tit y of re ag en ts , sa m pl es an d sp ac e th at oc cu rs du e to th e m in ia tu ri za tio n of th e te st ; C an be us ed fo r la rg e nu m be rs of sa m pl es ; C an te st th e su sc ep tib ili ty of m ul tip le an tim ic ro bi al s at th e sa m e tim e; En ab le s a la rg er nu m be r of re pl ic at es , in cr ea si ng th e ab ili ty of co nf id en t re su lts ; D oe s no t re qu ir e hi gh le ve ls of sk ill ; Le av es a pe rm an en t re co rd ; It de cr ea se s th e in te ns iv e la bo r an d tim e co st co m pa re d w ith ag ar -b as ed m et ho d; T he co ns id er ab le sa vi ng s in m ed ia us ag e; A ls o al lo w as si st an ce in ge ne ra tin g co m pu te ri ze d re po rt s if an au to m at ed pa ne l re ad er is us ed ; W or ks be tt er w ith an tib io tic s be ca us e no pr ec ip ita te fo rm s; C om pa re d w ith ag ar -b as ed m et ho d, br ot h m ic ro di lu tio n ca n de cr ea se m uc h la bo r an d tim e; Is co nv en ie nt ly us ed fo r ro ut in e an tim ic ro bi al su sc ep tib ili ty te st in g in cl in ic al la bo ra to ry ; Is a su ita bl e an d fa st sc re en in g m et ho d fo r M IC de te rm in at io n co m pa re d to ot he r m et ho ds . in co ns is te nt an d un re lia bl e re su lts be ca us e of po or gr ow th of st ra in s du e to ex ce ss iv e ex po su re to ox yg en du ri ng th e se t- up pr oc ed ur e; So m e in fle xi bi lit y of dr ug se le ct io ns av ai la bl e in st an da rd co m m er ci al pa ne ls . Standard methods for pollen research 83 T ab le 57 . Su m m ar y of so m e an tim ic ro bi al ef fe ct s of be e po lle n. Ph ar m ac ol og ic al ac tiv ity Su sc ep tib le m ic ro or ga ni sm s M et ho ds of de te rm in at io ns R ef er en ce s E. co li, S. au re us ,B .c er eu s an d P. ae ru gi no sa A ga r w el ld iff us io n A bo ud a et al .( 20 11 ) F un gi : As pe rg illu s fu m ig at us ,A sp er gi llu s ni ge r an d As pe rg illu s fla vu s. Y ea st s: Ca nd id a al bi ca ns (C .a lb ica ns ), Ca nd id a gl ab ra ta ,C an di da kr us ei an d Rh od ot or ul a m uc ila gi no sa . B ac te ri a: E. co li, S. au re us ,S al m on el la en t e ric a (S .e nt  er ica ), P. ae ru gi no sa an d Li st er ia m on oc yt og en es (L .m on oc yt og en es ) “ K ac  an io v a et al .( 20 12 ) L. m on oc yt og en es ,S .e nt  er ica ,E .c ol i, S. au re us an d P. ae ru gi no sa “ Fa tr co v a - S ra m ko v a et al .( 20 13 ) Cl os tr id iu m bu ty ric um ,C lo st rid iu m pe rf rin ge ns ,C lo st rid iu m hy st ol iti cu m ,C lo st rid iu m in te st in al e an d Cl os tr id iu m ra m os um “ K ac  an io v a et al .( 20 14 ) Pa en ib ac illu s la rv ae ,B ac illu s su bt ilis (B .s ub til is) ,B .c er eu s ,E .c ol i an d P. ae ru gi no sa “ Ba rb os a et al .( 20 06 ) S. au re us an d St re pt oc oc cu s py og en es “ C ab re ra an d M on te ne gr o (2 01 3) En te ro ba ct er ia ce ae ge ne ra “ H le ba et al .( 20 13 ) S. au re us an d St ap hy lo co cc us ep id er m id is “ Ba ltr u s ai ty te et al .( 20 07 ) Vi rid an s st re pt oc oc ci “ T ic hy an d N ov ak (2 00 0) Ag ro ba ct er iu m tu m ef ac ie ns ,P .s yr in ga e pv .t om at o, X . ax on op od is pv .V es ica t o ria ,E .a m ylo vo ra ,P .c or ru ga ta ,R . so la na ce ar um ,X .c am pe st ris pv .C am pe st ris ,A .v iti s, C. m ich ig an en sis su bs p. M ich ig an en sis ,E .c ar ot ov or a pv . ca ro to vo ra ,P .s av as ta no ip v. sa va st an oi ,P .s yr in ga e pv . Ph as eo lic ol a, P. sy rin ga e pv .s yr in ga e Pa pe r D is k di ffu si on Ba si m et al .( 20 06 ) S. au re us ,B .s ub til is, P. ae ru gi no sa ,K le bs ie lla sp .a nd B. ce re us “ C ar pe s et al .( 20 07 ) S. au re us ,B .C er eu s, B. Su bt illi s, P. ae ru gi no sa an d K. Pn eu m on ia e “ Ba su ny et al .( 20 13 ) E. co li, S. au re us ,B .s ub til is, P. ae ru gi no sa ,K .p ne um on ia , Sh ig el la fle xn er i, Sa lm on el la ty ph ia nd Pr ot eu s m ira bi lis “ Es w ar an an d Bh ar ga va (2 01 4) S. th yp hi m ur iu m an d E. co li. “ Y er lik ay a (2 01 4) S. au re us [A T C C 29 21 3] ,E .c ol i[ A T C C 27 85 3] ,E nt er oc oc cu s fa ec al is [A T C C 29 21 2] ,o r P. ae ru gi no sa [A T C C 25 92 2] M ic ro di lu tio n in M ic ro tit er pl at e El of f (1 99 8) S. au re us ,S .e pi de rm id is, E. co li, En te ro ba ct er clo ac ae ,K le bs ie lla pn eu m on ia ,P .a er ug in os a, C. al bi ca ns ,C .t ro pi ca lis an d C. gl ab ra ta “ G ra ik ou et al .( 20 11 ) Sa lm on el la ty ph i, S. au re us ,B .c er eu s, E. co li, Z yg os ac ha ro m yc es m el lis ,Z yg os ac ha ro m yc es ba ilii ,Z yg os ac ha ro m yc es ro ux ii an d Ca nd id a m ag no lia “ M or ai s et al .( 20 11 ) S. au re us ,P .a er ug in os a, E. co li an d C. gl ab ra ta “ Pa sc oa le t al .( 20 14 ) 84 M. G. Campos et al. 15.2. Materials and methods 15.2.1. Sample characterization and preparation The pollen samples are checked for the botanical origin based on the microscopic analysis, according the meth- odology described in Section 5. For FTIR-ATR analysis a representative part of each samples are carefully homogenizing and reduce to a fine powder (Figure 53). A small amount of sample is put in the apparatus with diamond solid ATR crystal properly mounter, and press against crystal (Anjos et al., 2017). 15.2.2. Reference analytical methods 15.2.2.1. Total phenolic and flavonoids content ana- lysis. The total phenolic content of the extracts was determined using the Folin–Ciocalteu method as described by Moreira et al. (2008). Total phenols con- tent is expressed as mg of Galic Acid equivalents per g of bee pollen (GAEs). For flavonoids contents the aluminum chloride method was used. Total flavonoids content is express as mg of catechin equivalents per g of bee pol- len (CAEs). 15.2.2.2. Antioxidant activity analysis. The antioxidant activity was assessed by calculating the 2,2-diphenyl-1- picrylhydrazyl (DPPH) free radical scavenging activity the trolox equivalent antioxidant capacity (ABTS) according the methodology proposed in Section 16. The concentration of the extract that induced a 50% inhibition (EC50) was calculated from the graphic of the percentage effect of eliminating radicals as a function of the concentration of the sample extract solution. For trolox results were expressed in millimol of equivalent trolox per gram of sample. 15.2.3. FTIR-ATR collection and data processing 1. The data acquisition and processing was described by Anjos et al. (2017). Pollen spectra are acquiring in a Bruker FTIR spectrometer with a resolution of 4 cm1 in the wavelength region 4000–400 cm1 (or similar) using a diamond single reflection attenuated total reflectance (ATR). 2. obtain a duplicate spectrum per sample, for example, with 32 scans per spectrum and calculate the average for each sample. 3. Note: A background measurement is made before each ten-sample analyzing using air. ATR crystal is carefully clean before and between each analysis with MilliQ water and isopropanol and the ATR crystal should be dried with soft tissue paper. All experi- ments are carried out at room temperature. 4. In a first screening all abnormal spectra are remove and if it was necessary a new sample spectra acquisi- tion is performed. 5. PLS regression is done by using OPUS 7.5.18 BRUKER software. Firstly, the spectral data from the calibration samples are regress against the measured parameters and by means of full cross-validation with one sample omitted in order to obtain a significant number of PLS components (rank). Different preprocess spectra could be tested for PLS analysis with the following methods: a. multiplicative scatter correction (MSC); b. minimum maximum normalization (MinMax); c. vector normalization (VecNor); d. straight line subtraction (SLS); e. constant offset elimination (ConOff); f. first derivative (1stDer); g. second derivative (2ndDer); h. combination of the previously methods namely 1stDerþMSC, 1stDerþVecNor, 1stDerþ SLS. For PLS analysis models with no spectral data processing (None) are tested. All models can be calculated to a maximum rank of 10 and the results of the cross-validation test for the better values of coefficient of determination (r2), root mean square error of cross-validation (RMSECV) and ratios of performance to deviation (RPD) (Anjos et al., 2018). 15.3. Concluding remarks These developed models have acceptable accuracy for the screening analysis for total phenolic compounds, total flavonoids and antioxidative capacity of bee pollen. They are fast and easy to handle and could give a good evaluation of the properties of bee pollen moisture available in the market. In the future is important pro- duce more robust models with a higher number of sam- ples, produced in different countries to have a better chemical characterization of the bee pollen to use in the labeling. A total of 134 pollen samples mixture was analyzed and the frequency of each plant genus as predominant pollen, secondary pollen, important minor pollen and minor pollen is represented on Table 52. The variability of genus observed in all samples is given by the richness of floral resources of the region where the bee pollen samples were collected. In a higher amount of samples, the Cistus spp and Echium spp pollen were the predom- inant. As secondary pollen the Castanea spp pollen was the highest representative genus found in 34 samples, followed by the Cytisus spp, Eucalyptus spp, Cistus spp and Echium spp. Castanea spp pollen was found in 60% of the samples from as Predominant pollen to minor pollen. The same distribution was observed for Cistus spp pollen that was presented in 61% of the analyzed samples. The spectra for pollen are very similar, like it can be observed in Figure 54, which shows the average spec- trum of different types of analyzed samples. All the spectra analyses are characterized by bands between 1600 and 900 cm1, which correspond to the signal Standard methods for pollen research 85 characteristic of the phenols compounds and is due to the C-C and C-O vibration of phenolic and flavonoids compounds. An absorbance band appeared at 1632 cm1, which could be assigned to the carboxyl group in asymmetric stretching, presented also in the honey samples (Anjos et al., 2015). The band from 3400 to 3000 cm1 is usually associated to the water content in the samples because is due to OH groups but this groups are also important in the identification of phen- olic compounds, alcohols and carboxylic groups and also the hydrogen vibration of amide N-H groups from olive wastewater samples (Droussi et al., 2009). The water content in this kind of samples usually varies between 6 and 8%. The other important bands that were observed in bee pollen samples are described in Anjos et al. (2017). Table 53 summarizes the statistical data for each par- ameter evaluated. The higher values of coefficient of variation denote the variability of data important for good model calibration. The samples data must be div- ided into two parts, one for calibration (30% to 50% of data) and the other for validation set (70% to 50% of data). PLS multivariate analysis was done with spectral data in order to obtain calibration models for each ana- lyzed parameter in pollen samples. The calibration mod- els determination of total phenolic compounds, total flavonoids and antioxidant capacity in pollen mixtures were developed based on the highest r2, lowest stand- ard error of calibration and cross-validation, lower number of factors used in the calculation and higher residual prediction deviation. Table 54 represents the results for optimal calibration established. Values of r2 for selected models were greater than 0.859 for calibra- tion and greater than 0.72 for the Cross validation. The worst model founded was for the ABTS with a lower RPD for cross-validation. In calibration all models pre- sent values of RPD higher than 2.7. However, more accurate model could be obtained with more samples, from different regions and countries. 16. Standard methods for determination of antioxidant bioactivity 16.1. Introduction Bee pollen is considered as an important source of anti- oxidant flavonoids and phenolic acids for human con- sumption. Given the complex composition (view the first sections of this chapter), the natural variation of that composition, the storage conditions (Campos et al., 2003; Melo & Almeida-Muradian, 2010), the different ways to prepare the pollen extracts, and the different assay conditions to evaluate the antioxidant capacity, the determination and comparison of antioxidant cap- acity is difficult to assess. A great deal of methods for assessing the antioxidant capability of foods and bever- ages have been developed, and reviews on this topic have been published (Prior et al., 2005). In this section, a proposal for standardizing some methods to assess the antioxidant levels of bee pollen is done. As the anti- oxidant capacity varies with the type of oxidants, more than one assay is needed (Niki & Noguchi, 2000). - DPPH free radical scavenging activity and the oxygen radical absorbance capacity (ORAC) methods are pro- posed for standardization of the routine assessment of bee pollen antioxidant capacity; the former because of its wide use in bee pollen, easiness of doing it, and good correlation with other assays like b-carotene bleaching (Morais et al., 2011) among others; and the Figure 54. Average ATR spectrum of pollen samples. 86 M. G. Campos et al. second one because of it has been proposed to be con- sidered for standardization for foods, botanicals, nutra- ceuticals, and other dietary supplements (Prior et al., 2005), and this would allow to compare this property between bee pollen and any other food. 16.2. Methods 16.2.1. 2,2-diphenyl-1-picrylhydrazyl (- DPPH) free radical scavenging activity principle - DPPH is a stable organic nitrogen free radical. It has a spare electron, which being delocalized in the mol- ecule, confers a deep violet color and makes the com- pound no capable to form dimers (Molyneux, 2004) neither reacts with oxygen (Ionita, 2005). In ethanolic or methanolic solutions, - DPPH absorbs between 515 and 528 nm (Almaraz-Abarca et al., 2004; Molyneux, 2004; Sanchez-Moreno, 2002), but when it is mixture with a reducing substance, the reduced form of -DPPH (- DPPH-H, 2,2-diphenyl-1-picrylhydrazine) is formed (Ionita, 2005), then the deep purple color becomes to a pale purple and eventually, this becomes to a pale yellow. The wide range of maximum absorb- ance reported for the alcoholic - DPPH solution indi- cates that the kmax must to be determined under a given set of particular conditions. Stoichiometric deter- minations have indicated that two moles of - DPPH are reduced by one mole of water soluble vitamin E ana- logue (Trolox) (Leong & Shui, 2002), but the interaction of a potential antioxidant with -DPPH depends on its structural conformation (Kaur & Kapoor, 2001). In a -DPPH assay, this molecule represents the radical formed in a system suffering oxidation and the antioxi- dant to evaluate represents the reductant compound. Although the -DPPH scavenging activity can be eval- uated by electron spin resonance (Wasek et al., 2001; Yu, 2001), the evaluation of the absorbance reduction at 515 to 528 nm when in contact with a hydrogen donator compound by using visible spectroscopy, is the most common manner of evaluation. A quantitative esti- mation of the activity using visible spectroscopy is based on the registration of the differences between the initial concentration of -DPPH in the reaction medium and its diminution with increased amounts of antioxidant. The -DPPH scavenging activity of one sample can be expressed as the percentage of -DPPH free radical scavenging remaining in the reaction (Equation (1)). %DPPHremaining ¼ ½½DPPHremaining=½- DPPHinitial 100 (1) That manner has been used to express the -DPPH scavenging activity in around 65.6% of reports concern- ing bee pollen. However, this activity can also be expressed in terms of the efficient concentration at 50% (EC50), defined as the amount of antioxidant needed for reducing by 50% the initial concentration of -DPPH, the larger the EC50 the less efficient the antioxidant. Sanchez-Moreno et al. (1998) have proposed that besides the concentration of antioxidant, the reaction time to reach the plateau of the scavenging reaction should be taken in account for estimating this activity, according to Equation (2). Results from quercetin evalu- ations suggest that the increasing in the reductor com- pound do not affect the time to reach the plateau (Campos, 1997). AE ¼ 1=ðEC50ÞðTEC50Þ (2) where AE means the antiradical efficiency, EC50 the effi- cient concentration at 50% and TEC50 the time needed to reach the steady state with EC50. As both -DPPH and phenols are highly soluble in methanol and ethanol, the antiradical activity is eval- uated in either of those solvents without apparent interference with the reaction; other solvents, like water and acetone seem to under estimate the extent of reduction (Guo et al., 2020). The use of buffered methanolic solutions has been reported for the evalu- ation of antiradical activity of bee pollen (Wang et al., 2010); that solvent can affect the estimation of IC50 in methanol and buffered methanol for antioxidants like BHT, but the effect is lower for phenolic antioxidants like propyl gallato, which bears several hydroxyl groups, being the IC50 values comparable in both kinds of sol- vents (Sharma & Bhat, 2009). A great variation in the initial concentration of -DPPH solution can be found in many reports of the antiradical activity. According to Molyneux (2004), that concentration should be in the range of 50 to 100 mM in order to get solutions giving absorbance values less than 1, thus, observing the normal practice in spectrophotom- etry to reach accurate measurements. The range given by Sharma and Bhat (2009) was 25 to 70 mM. Concerning the stability of the -DPPH solution, its spectrum (200 to 700 nm) did not reveal neither molecular nor quantitative alterations after eight hours in light (Campos, 1997). For longer periods, the free radical activity of the -DPPH solution is reduced about 2 to 4% per week (Molyneux, 2004). Among the disadvantage of -DPPH assay are the reversibility of the initial step of the reaction (Bondet et al., 1997) and the fact of some substance, like pro- teins, most likely present in total extracts of plants, can precipitate in the alcoholic reaction medium (Sanchez- Moreno, 2002). Prior et al. (2005) informed about the following three disadvantages of this assay, the not easy interpretation when the test compounds have spectra overlapping -DPPH kmax; the overestimation of the activity for small molecules, having better access to the radical site (steric accessibility); and the inaccurate interpretation of the antioxidant activity for a given sample because -DPPH solutions are decolorized by both reducing and hydrogen atom transfers. Contrary, among the advantage of the -DPPH free radical scav- enging activity are that it is a rapid method, does not Standard methods for pollen research 87 have to be generated previously to the proper radical scavenging as in other assays, the compound is commer- cially available, the method is accurate and reproducible, and needs only a UV-Vis spectrophotometer or a color- imeter to perform. Also, - DPPH assay is independent of sample polarity (Koleva et al., 2002). Besides, good correlations between this assay and TEAC (Marghitas¸ et al., 2009) and with b-carotene bleaching assay (Morais et al., 2011) have been reported, meaning that -DPPH test may represent a good approaching to evaluate the antioxidant activity for complex samples like bee pollen extracts. There is a high correlation between the decreasing of DPPH concentration and the increasing of flavonoid or phenolics concentration in the reaction medium (Almaraz-Abarca et al., 2004, 2006, 2008; Barriada- Bernal et al., 2014). However, a clear correlation between the DPPH scavenging activity and the flavon- oid or phenol concentration in different samples has not been found in all systems (Morais et al., 2011; Negri et al., 2011). This suggests that the types of phenolics present in a particular combination in a given sample are involved in the manifestation of the antioxi- dant properties. Sanchez-Moreno (2002) informed about a long list of compounds from different sources analyzed with the -DPPH assay, which could be update with the reports concerning the bee pollen activity. 16.2.1.1. Variations in the - DPPH assay for bee pol- len. The main variations of the -DPPH assay found in the several reports concerning bee pollen refer to the -DPPH concentration of the solution used to carry out the analysis, reaction time, and the proportion of volume of - DPPH solution related to volume of extract or sample to analyze (Table 55). Differences are also found in the form of expression of the activity. Under this situation important difficulties are to be faced when comparisons of scavenging activity of differ- ent bee pollen samples are done. Thus, the expression of the antiradical activity in terms of IC50 would repre- sent a more accurate activity than the expression in terms of % activity, which is estimated at one extract concentration selected in an arbitrary manner and men- tioned in the reports only in few cases. 16.2.1.2. Material and methods for - DPPH assay. 1. Prepare a solution of - DPPH in ethanol or methanol (depending on the solubility of the compounds to be tested), and calculate the UV-Vis absorption that should be close to 1 (Absorption Unities – AU). The concentration of the free radical depends according to the method choose (see Table 55). 2. Prepare a test solution with the sample. For bee pol- len a ratio of 10mg/ml of solvent can be used as a start point. After a preliminary assay, if needed, differ- ent concentration of the simple solution can be done. 3. Measure 1 or up to 4ml of - DPPH according to the method choose (see Table 55) for at least 5 test tubes. 4. Add to each different concentration of the sample sol- utions and adjust with solvent for an equal final vol- ume in each test tube. Example: 1ml of - DPPH solution þ (50 ml extract þ 950 ml of solvent), to complete a final volume of 1ml. 5. Wait the time necessary for the complete reaction, according to the method choose (see Table 55) 6. Measure the absorption at 517 nm in the visible range with a spectrophotometric system. 7. Do a chart with the concentration of the sample and the respective consume of -DPPH. Example: O mg of sample þ 1ml of - DPPH correspond to 0.96AU. These values correspond to zero activity. When the concentration of the sample increase (if active) the -DPPH solution absorption decreases and then is possible to determine the concentration of the sample necessary to decrease this AU to 50% corresponding to the EC50. 8. Proceed as above utilizing a standard (ascorbic acid, trolox, various flavonoids or other polyphenols, depending of the simple under evaluation) for com- parison of the results and to validate the accuracy of the assay. 16.2.2. Antioxidant capacity using ORAC (oxygen radical absorbance capacity) assay principle The ORAC method measures the sequestrating capabil- ity of an antioxidant against the induced radical 2,20-azo- bis(2-amidinopropane)dihydrochloride (AAPH) in reactions which are temperature sensitive; 37 C is the most frequent temperature of assay. The radical reacts with a fluorescent compound forming a nonfluorescent product. The protector effect of antioxidant is esti- mated by calculating the area under a fluorescence decreasing curve over time, comparing with a reference substance, which is not an antioxidant. ORAC method was developed by Glazer (1990), using phycoerythrin, but currently fluorescein and dichlorofluorescein are preferred because of their stability and less reactiveness (Prior et al., 2005). At present, ORAC assay is highly automated. Special plates of fluorometers are used. Arruda (2013) used plate wells for 300 ll, and it was used for the external ones 300 ll of distilled water. Other holes were filled with 25 ll of phosphate buffer (blank) and the others with 25ll of the extract dilutions. Then it was injected 150 ll of fluoresceine, waits for 30minutes, and then injected 25ll of the AAPH solution to initiate the reaction of peroxyl radical with the fluorescein (oxy- gen radical absorbance capacity). ORAC values are usu- ally expressed as Trolox equivalents/g sample, then a standard curve using three to five concentrations of TroloxVR (25ll) vs. the fluorescence intensity is con- structed. ORAC unit is equivalent of a protection against oxidation offered by a 1 mmol of Trolox. The 88 M. G. Campos et al. fluorescence must be monitored every minute, using as work temperature 37 C. It is used extinction wavelength at 493 nm (485/20 filter) and at 515 nm (filer 528/20) of emission. For calculation, it is used the sample area under the curve of the testing compounds minus the area of the blank. The same calculation is made for the Trolox curve. The area under the curve (AUC) is calculated after 30minutes, when it is injected 25ll of the AAPH solution to start the reaction, this delay in the starting of reaction avoids underestimation of antioxidant activity due to effects of secondary potential antioxidant products (Prior et al., 2005). The area under the curve (AUC) is calculated using Equation (3). AUC ¼ 1þ XN i¼1 fi f0 where fo ¼ initial fluoresence at time zero; fi ¼ fluores- cence registration after i At the beginning of the reaction kinetics there is a time in which the fluorescence is maintained, this is the lag phase, in it there is no consume of peroxide by fluorescent probe due to the presence of the antioxi- dants and consequently enhance the area under the curve. Prior et al. (2005) consider that methods like ORAC, which measures the antioxidant capacity by AUC, take in account both inhibition time and degree; this gives a more accurate estimation of the action of an antioxidant than the methods which are based on the evaluation at a fixed time or inhibition degree. 16.2.2.1. Material and methods for antioxidant activ- ity (ORAC) assay. The ORAC procedure recommended use an automated plate reader (Synergi HT, Bio TeK, USA) with 96-well plates (Arruda et al., 2013; Ou et al., 2001), as follows: 1. Conduct all the analyses in a pH 7.4 (75mM) phos- phate buffer at 37 C under condition with a blank sample in parallel. 2. Dilute the extracts with sodium phosphate buffer (75mM, pH 7.4). Peroxyl radical will generated using 2, 20-azobis (2-amino-propane) dihydrochoride aque- ous solution – that will be prepared for each run (153mM). Fluorescein will be used as sub- strate (40 nM). 3. Program the ORAC analyzer to record the fluores- cence of FL every minute after addition of AAPH. All fluorescent measurements express relatively to the initial reading. Fluorescence analysis conditions are performed as follows: excitation at 493 nm (filter 485/ 20) and 515 nm (filter 528/20). The standard curve must be linear between 6.25 and 100 mM TroloxVR . 4. Calculate the final results using the differences of areas under the FL decay curves between the blank and a sample and express as mM TE/g bee pollen. 16.3. Concluding remarks The great diversity of bee pollen that can be found worldwide, varying in the antioxidant capabilities, encourages to propose standard evaluations for this property, allowing a comparison among bee pollens from different geographical and botanical origins. Standards evaluations also would be useful for under- standing the effects of several environmental factors on the antioxidant properties, and for monitoring bee pol- len quality. 17. Standard methods for anti-inflammatory activities in bee pollen 17.1. Introduction The inflammation process has been defined by several pathologists with different approach. Most pathologists would probably agree that inflammation represents a response of living tissue to local injury; that it leads to the local accumulation of blood cells and fluid (Ryan & Majno, 1977). Briefly, inflammation is a physiological response to the damage of tissues or cells that is caused by physical or biological agents and also free radicals involving different reactions intended to remove the cause and repair the damage (Bogdanov, 2015). Paulino et al. (2008) defined the inflammation as the process that involves production and/or release of mediators from neurons or damaged tissues, which are responsible for different responses including pain. For determination of standard methods on anti- inflammatory activities much methodology in vitro and in vivo has been developed by several researchers worldwide. Recently Pascoal et al. (2014) following the methodologies in vitro described by da Silva et al. (2012), present a method based on the measurement of the inhibitory effect of bee pollen (BP) on the reactions catalyzed by hyaluronidase was evaluated. 17.2. Determination of standard methods 17.2.1. Anti-inflammatory activities of BP in vitro 17.2.1.1. BP extract preparation. For BP extract prep- aration the procedures described by Pascoal et al. (2014) are described below regarding to the procedures. 17.2.1.1.1. Materials and reagents. 1. BP sample(s). 2. Methanol (CH3OH). 3. Whatman filter paper No. 4. 4. Flasks. 5. Rotary vacuum evaporator. 17.2.1.1.2. Procedure. Note: The sample concentration and diluents used varies from the author to other: 1. BP and Methanol (MeOH) were mixed (1:2) (w/v). 2. Macerate for 72 h at room temperature. Standard methods for pollen research 89 3. Then, the solution was filtered by Whatman filter paper No. 4. 4. The solid residue was re-extracted. 5. Mix the two filtered into a flask, thus obtaining the methanol extracts of bee pollen. 6. Evaporate the extracts on a rotary evaporator at 45 C for approximately 1h. 7. Finally, the dried extract of pollen was stored in the dark at room temperature, for further analysis. 17.2.1.2. BP sample preparation. 17.2.1.2.1. Materials and reagents. 1. BP extract. 2. Hyaluronidase enzyme (Type IV-S: bovine testes). 3. Calcium chloride (CaCl2). 4. Hyaluronic acid sodium salt. 5. Potassium tetraborate (K2B4O7 4H2O). 6. Water-bath. 7. p-dimethylaminebenzaldehyde (DMSO). 8. Spectrophotometer. 17.2.1.2.2. Procedure. 1. Prepare BP extract concentrations [5mg/ml – 25mg/ ml] using dimethyl sulfoxide (DMSO) as solvent. 2. Prepare a mixture of 50 ll of BP’ extract and 50ll (350 units) of hyaluronidase enzyme (Type IV-S: bovine testes). 3. Incubate at 37 C for 20min. 4. Add 1.2ll of calcium chloride (2.5 103 M/l) to activate the enzyme. 5. Incubate at 37 C for 20min. 6. Add 0.5ml of hyaluronic acid sodium salt (0.1 M/l) to start the reaction. 7. Incubate the mixture at 37 C for 40minutes. 8. Then add 0.1ml of potassium tetraborate 0.8 M. 9. Incubate in boiling water bath for 3minutes. 10. Place the mixture at 10 C. 11. Add 3ml of (DMSO). 12. Afterwards incubate at 37 C for 20minutes. 13. Measured the absorbance at 585 nm using water as control. 17.2.2. Anti-inflammatory activities of BP in vivo 17.2.2.1. BP extract preparation. For BP extract prep- aration the procedures described by Maruyama et al. (2010) are suggest. 17.2.2.1.1. Materials and reagents. 1. BP sample(s) 2. Ethanol (EtOH) and others. 17.2.2.1.2. Procedure. 1. BP (200 g) extracted with water (Water BP) or 95% ethanol (EtOH BP). 2. Stir for 4 h at 60 C (Water BP) or stir for 16 h (EtOH BP) at room temperature. 3. Take the filtrate to dryness and powdered. 4. The yields are stored for further use. 17.2.3. Animals For the animal experimental protocol procedures, the Guide for the Care and Use of Laboratory Animals Eighth Edition (2011) is suggested. 17.3. Concluding remarks The high anti-inflammatory effects of BP compared to such nonsteroidal anti-inflammatory drugs as naproxen, analgin, phenylbutazone, or indomethacin also has been reported (Pascoal et al., 2014). The mechanism of the inflammatory effect is about inhibiting the activity of enzymes (cyclooxygenase and lipoxygenase) which are responsible for turning arachidonic acid into such toxic compounds as prostaglandin and leukotrienes, inducing acute and chronic inflammatory conditions in tissues. Flavonoids and phenolic acids are mainly responsible for such actions, but fatty acids and phytosterols also take part in this process (Akkol et al., 2010; Choi, 2007; Komosinska-Vassev et al., 2015; Pascoal et al., 2014). Kaempferol it is a compound present in BP and has been attributed ability to inhibit the activity of two enzymes: hyaluronidase, which is the enzyme catalyzing depolymerization of hyaluronic acid, and elastase, which hydrolyzes elastin, strengthens the connective tissue and seals blood vessels. This results in decreased tran- sudates, inflammatory reactions and swellings. Blood cir- culations in the vessels improve and, therefore, skin becomes moistened and tight. Quercetin another fla- vonoid compound with several bioactivities as anti- inflammatory, antiedematous and analgesic action, may result by inhibiting the activity of histidine decarboxyl- ase, lowers the histamine level in the organism (Kanashiro et al., 2007; Lee et al., 2009; Sahin et al., 2011). Studies done by Lee et al., 2009 in order to elu- cidated the anti-inflammatory activities of several sub- class flavonoids such as the antioxidant property, inhibition of NO production, and inhibition of inflamma- tory enzymes (hyaluronidase, collagenase, LOX, and COXs), found that Kaempferol, quercetin, myricetin, and rutin inhibited hyaluronidase reaction, while apige- nin, baicalin, and baicalein showed specific inhibition to collagenase reaction and catechin, which is flavon-3-ols- subclass, had suppressed both hyaluronidase and colla- genase reaction. The degradation of the hyaluronic acid by the hyaluronidase enzyme may cause bone loss, inflammation and pain. As consequence, the determin- ation of the hyaluronidase enzyme is an indirect way to assess the anti-inflammatory activity (da Silva et al., 2012). Choi (2007) evaluated the antinociceptive and anti-inflammatory activity of pine (Pinus densiflora) pollen in mice. The antinociceptive activity was determined using acetic acid-induced abdominal constriction and formalin-induced licking, and the hot plate test and anti- inflammatory effects were evaluated using carrageenan and formalin-induced paw edema, and arachidonic acid- induced ear edema. The obtained results showed that 90 M. G. Campos et al. ethanol extract of pine pollen (100 and 200mg/kg) pro- duced a significant inhibition of both phases of the for- malin pain test in mice. Also, the pine pollen extract produced a significant inhibition of carrageenan and for- malin-induced paw edema as well as arachidonic acid- induced ear edema in mice. These activities could be due to different polyphenols found in pine pollen related with antinociceptive and anti-inflammatory actions. Among other flavonoids, Chrysin has been reported as to possess anti-inflammatory activity, anti- oxidant properties and promotes cell death by perturb- ing cell cycle progression (Pichichero et al., 2011). Another studies developed by Maruyama et al. (2010) in order to investigate the anti-inflammatory effect of bee pollen from Cistus sp. of Spanish origin by a method of carrageenan-induced paw edema in rats, and to investi- gate the mechanism of anti-inflammatory, found that the ethanol extract of bee pollen show a potent anti-inflam- matory activity and its effect acts via the inhibition of nitric oxide (NO) production, besides the inhibitory activity of COX-2. Maruyama et al. (2010) and, reported that some flavonoids found in plant foods included also in BP may partly participate in some of the anti-inflammatory action. Therefore, the anti-inflam- matory effects of BP may be due to their flavonoids compounds as Kaempferol, quercetin, myricetin, and rutin that inhibit the inflammatory enzymes such as hya- luronidase, collagenase, LOX, and COXs, helping the retardation of inflammatory responses. 18. Standard methods for antimicrobial activities in bee pollen 18.1. Introduction In order to investigate new antimicrobial agents from extracts of plants and other natural products to be used in pharmaceutical and cosmetic products, several methods have been developed by several researchers for evaluate the antibacterial and antifungal activity of the plant extracts. Nowadays, the most known assays have been based on diffusion in agar, macro and micro- dilution methods (Ostrosky et al., 2008). Table 56 shows the advantages and disadvantages of these meth- ods with references. Microdilution methods have been reported as the most widely used testing methods that use commercially marketed materials and devices, and the manual methods that provide flexibility and possible cost savings include the disk diffusion and gradient diffu- sion methods (Jorgensen & Ferraro, 2009). Some meth- ods provide quantitative results and all provide qualitative assessments using the categories susceptible, intermediate or resistant. Also, it’s important to high- light that all of these methods have strengths and weak- nesses, including organisms that may be accurately tested by the method; but in general way, these current testing methods provide accurate detection of common antimicrobial resistance mechanisms (Jorgensen & Ferraro, 2009). According to the information available the diffusion in agar technique is widely used but problems associ- ated with this have been reported. However, the Micro- dilution technique in microtiter plate (96 wells) has been proved to be quick provides reproducible results and was useful in screening plants for antimicrobial activity. All of these methods have been reported that each of them has strengths and weaknesses. Also, it is import- ant to highlight that those methods are widely used in the worldwide by several researchers for antimicrobial activities determinations but sometimes suffer minor modifications (Estevinho et al., 2008). 18.2. Materials and methods 18.2.1. BP sample collection Accordingly, with Morais et al. (2011), for getting BP samples from beekeepers, the selected beehives were equipped with bottom-fitted pollen traps. After dried the BP, the samples were delivered to the Microbiology Lab, where they were stored in a dark place at room temperature (20 C) for further analysis. 18.2.2. Extract preparation of BP for antimicrobial analysis Nowadays, many experiments in vitro and in vivo are performed with Pollen Methanolic Extracts (PME) and Pollen Ethanolic Extracts (PEE) to confirm its antimicro- bial activity. According to the revised bibliography, once the pollen is received in the laboratories from beekeep- ers the methods for samples preparation commonly used are based on Methanol (MeOH) (Graikou et al., 2011; Kacaniova et al., 2012; Pascoal et al., 2014) and Ethanol (EtOH) (Eswaran & Bhargava, 2014; Hleba et al., 2013; Kacaniova et al., 2014) pollen extracts. In dependence of the final concentration desired, amounts of BP are weighted and dissolved in methanol or etha- nol aqueous solutions. These methodologies have been used by several researchers with some modifications. The BP extracts could be prepared accordingly with Pascoal et al. (2014) as described below regarding to the procedures: 1. The sample concentration and diluents used varies from the author to other. 2. Place the mixture under magnetic stirring at 150 rpm for 1h. 3. Filtration using Whatman No. 4 paper. 4. Repeat this procedure once more. 5. Mix the two filtered into a flask, thus obtaining the methanol extracts of BP. 6. Evaporate the extracts on a rotary evaporator at 45 C for approximately 1h. 7. Keep extracts in dark and in refrigeration until their further use. Standard methods for pollen research 91 8. Preparing different sample concentrations using dimethyl sulfoxide (DMSO) as solvent. 18.2.3. Antimicrobial analysis by agar disk diffusion 18.2.3.1. Preparation of inoculum suspension. The preparation of inoculum could be accordingly with Matuschek et al. (2014) with bit modifications as described below regarding to the procedures: 1. Inoculate the bacteria in broth of Muller Hinton Agar or Brain Heart Infusion Broth (BHIA); and Sabouraud dextrose Agar or potato dextrose agar for yeast. 2. Incubate for 18 to 24 hours for bacteria and 48 h for yeast. 3. Inoculate 3 to 4 colonies of bacteria in 5ml Tryptic Soy Broth (TSB) and use Yeast Extract Peptone Dextrose (YPD) for yeasts. 4. Incubate at 37 C for bacteria and 25 C for yeast until to reach an optical density 0.5 of Marc Farland standard, which is equivalent approximately from 1–2 108 CFU/ml for bacteria and 1–5 106 UFC/ml for yeasts. Note: Alternatively, may prepare directly from the culture medium with agar 18 to 24 hours for bacteria and 48 hours for yeast, suspending the colony in saline or sterile nutrient broth until an optical density of 0.5 Marc Farland standard, to perform this step properly, either a photometric device should be used or, if done visually, adequate light is needed to visually compare the inoculum tube and the 0.5 Marc Farland standard against a card with a white background and contrasting black lines. For 0.5 Marc Farland standard preparations, see Cavalieri et al. (2005) on page 220. 5. With swab, remove a small portion of inoculum is evenly spread on plates containing Muller-Hinton broth by passing the swab over the entire surface in three directions. 6. Let dry for 5minutes. 7. Apply 10 ml of the antimicrobial solution on filter paper disks of 6mm in diameter, at different concen- trations to be tested. 8. Place the antibiotic disks on the agar surface using sterile forceps, by pressing the agar. 9. Let the plates 15minutes at room temperature, in order to initiate diffusion of antibiotics. 10. Incubate the plate upside down at 37 C for 18 to 24 hours. 11. Measure the diameter of the inhibition zones with a ruler. To facilitate the measurement, the plates should be placed in a dark background surface. Figure 55 shows the inhibition zone around the disk. 18.2.4. Antimicrobial analysis by agar well diffusion 18.2.4.1. Preparation of inoculum suspension. The preparation of inoculum could be accordingly with (Clinical and Laboratory Standards Institute (CLSI), 2012) with bit modifications as described below regard- ing to the procedures: 1. Please, see proceedings described in points 1 to 6 regarding to agar Disk diffusion, then, follow the next step. 2. Forming wells in the culture medium previously inocu- lated from 6 to 8mm, with the aid of stainless- steel cylinders. 3. Fill the wells with 100 ml of the substances to be analyzed. 4. Incubate the plate upside down at 37 C for 18 to 24 hours for bacteria and yeast to 25 C for 48 h. 5. Measure the diameter of the inhibition zones with a ruler. To facilitate the measurement, the plates should be placed in a dark background surface. Note: Use a positive control (may be an antibiotic) and a negative control (solvent used for dissolving the dry extract in different concentrations); The disks are positioned at 15mm plate edge and widely separated from each other, so there is no overlap of zones of inhibition (approximately 20mm). The pH of the culture medium should be between 7.2 and 7.4, and the recom- mended depth is approximately 4mm (Barry & Thornsberry, 1991). Figure 56 shows the inhibition zone around the well diffusion. 18.2.5. Antimicrobial analysis by micro-dilution in microtiter plate (96 wells) 18.2.5.1. Preparation of inoculum suspension. The preparation of inoculum could be accordingly with Cavalieri et al. (2005) in Manual of Antimicrobial Susceptibility Testing, with bit modifications as described below. Procedure 1. In sterile 96 well microplate, placing 200 ml of the sample (pollen extract) in the wells of the first column. Figure 55. Inhibition zones around the disks. 92 M. G. Campos et al. 2. In wells 2 to 8 and 11 to 12 put 100 ml medium (nutrient broth), the wells 11 and 12 being the posi- tive control. 3. In wells 9, 10 (negative control), putting 200 ml of medium. 4. Perform serial dilutions until the well 8. 5. Please, see proceedings described in points 1 to 4 regarding to agar Disk diffusion, then, follow the next step. 6. Then, within 15minutes of adjusting the inoculum to the 0.5 Marc Farland turbidity standard, mix the sus- pension and dilute it so that the final concentration in each well is 5 x 105 CFU/ml. Deliver 2.0ml of the original suspension into 38ml of water (1:20 dilu- tion). From 1:20 dilution, prepare another 1:10 dilu- tion that will be the inoculum. 7. Add 100 ml of inoculum in each well except for the columns 1, 9 and 10. Inoculate MIC panel carefully to avoid splashing from one well to another. Failure to adjust the inoculum and to dilute it within 15minutes may adversely affect the concentration of organisms and test results. 8. Cover the microplate with a breathable film. 9. Incubate the yeast to 48 hours at 25 C and the bac- teria at 37 C for 24 hours. 10. After this period, all wells except the first column, add 20 mL of TTC (2, 3, 5-triphenyl tetrazolium chloride) at 1%. 11. Incubate plates again for another 3 hours at 37 C and 25 C for bacteria and yeast, respectively. 12. Reading: See the color change (red/pink), indicating the reduction of TTC by microorganisms. The min- imum inhibitory concentration (MIC) is defined as the lowest concentration of pollen extract that is capable of inhibiting visible growth, as indicated by TTC staining. Figure 57 shows the color change indi- cating the reduction of TTC by microorganisms in the wells of microplates. 18.2.5.2. Calculating the lethal concentrations. 1. After reading the microplates at 48 hours. 2. Seeding in plates (Mueller-Hinton agar for bacteria and Sabouraud for yeasts) in duplicate 20 ml of each of the wells in which there has been no microbial growth and the last in which growth was obtained. 3. Then mix thoroughly the contents of each well. 4. Once homogenized, inoculate 20 ml of each well in duplicate plates in their respective medium. 5. Incubate during 24 and 48 hours for bacteria and yeast respectively. 6. Then make counts. 7. If they are <10 or >10 CFU means that the sub- stance has bactericidal and bacteriostatic activity, respectively. 18.3. Concluding remarks The Agar well diffusion techniques (Table 57) are used widely, problems associated with this technique are reported in Table 56). Therefore, Morais et al. (2011), Graikou et al. (2011) and Pascoal et al. (2014) used a Micro-dilution technique because is quick, worked well with Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa (P. aeruginosa), and Escherichia coli (E. coli) also this method gave reproducible results; provided a permanent record of the results and was useful in screening plants for antimicrobial activity (Eloff, 1998). Although BP has antimicrobial properties, it is important to highlight that these properties are depend- ing on the type of pollen, concentrations applied and the inhibitions can occur against different species of bac- teria and inhibition ratios can also vary (Carpes et al., 2007; Erkmen & Ozcan, 2008). For elucidate these affir- mations, Campos et al. (1998) and Erkmen and Ozcan (2008) in their studies when investigated the antibacter- ial activities of BP on some bacteria, yeasts and molds, the obtained results showed that, the used concentra- tions had no antimicrobial effect on the bacteria and fungi. Carpes et al. (2007) in their studies found similar results as previously mentioned researchers. In general way the results obtained by all of cited researchers Figure 56. Inhibition zone around the well diffusion. Figure 57. Microtiter plate (96 wells), showing the color change indicating the reduction of TTC by microorganisms. Standard methods for pollen research 93 even if the methodologies applied were different showed that the Gram-negative bacteria were more resistant to the BP action than the Gram-positive bac- teria, what may be related with the additional outer layer membrane, impermeable to most molecules, that consists of phospholipids, proteins and lipopolysacchar- ides (Silici & Kutluca, 2005). 19. Determination of standard methods for anti- mutagenic activities in bee pollen 19.1. Introduction Some published studies, reported the beneficial effects of BP to human health such as the prevention of prostate problems (Shoskes, 2002) and tumors (Zhang et al., 1995). The increase of the of the large number of mutagens that has widespread in the world, led to researchers to investi- gate and discovering anti-mutagenic materials that limit and stop the harmful effects of mutations on the physiology of the organism. The most important of these materials has been reported as a plant extracts (Jaiswal et al., 2014). Over the past decade, some studies have lauded the anti- mutagenic properties of diverse beekeeping products, such as BP, propolis, honey mixtures and royal jelly, against the influence of some chemical and physical mutagens (Bariliak et al., 1996). Recently, studies done by Abdella et al. (2009) and Tohamy et al. (2014) when studied the protective effi- ciency of Egyptian BP extracts and propolis, treated mice with cisplatin [cis-diammine-dichloro-platinum(II)] (CDDP), observed that BP extracts presented potential chemoprotective against CDDP induced genotoxicity in mice by another side found that the chemoprotective fre- quency of BP extracts was much greater than propolis. Cisplatin (CDDP) is known as an inorganic platinum com- pound with a broad spectrum anti-neoplastic activity against different types of human tumors as testicular, ovar- ian, breast, lung, bladder, head and neck cancer (Khynriam & Prasad, 2003; Pabla et al., 2008; Siddik, 2003). The geno- toxicity action of CDDP is due to its ability to bind with DNA, block and prolong the cell division in the G2 phase that is related to the inhibition of chromatin condensation (Aly et al., 2003). Bariliak et al. (1996) when studied apicul- ture products (propolis, beebread, honey and queen bee milk) observed a chemoprotective effect of these beehive products against the influence of some chemical and phys- ical mutagens. BP was able to reduce the chromosome damage induced by the three cancer drugs used, thus sup- porting their use as a chemoprotective agent (Shi et al., 2010). 19.2. Determination of standard methods for anti- mutagenic activities in BP 19.2.1. Preparation of BP extracts Different methods for preparations of BP extracts have been reported (Carpes et al., 2007; Kaur et al., 2015; Pascoal et al., 2014; Pinto et al., 2010). Procedure (according with Kaur et al., 2015). 1. The sample concentration and diluents used varies from the author to other. 2. Milling 1 g of pollen grains. 3. Homogenize with the help of needle in Petri dish. 4. Add 7.5ml of 70% ethanol to the pollen mixture. 5. Keep at 70 C for 1 h with agitation of 1min after every 10min interval. 6. Separate the supernatant. 7. Re-extract solid residue with 70% ethanol. 8. Repeat the process 3–4 times. 9. Group supernatants in a 25ml conical flask. 10. The collected supernatant is considered as 100% extract. 11. Store these extracts at 5 C till further analysis. 12. Prepare different concentrations viz., 25%, 50%, 75% and 100% of pollen extracts using double dis- tilled water. 19.2.2. Anti-mutagenic activities in vitro 19.2.2.1. Materials and reagents. a. BP. b. Ethyl methanesulfonate (EMS) and other chemicals. c. Methanol (CH3OH) and ethanol (CH3CH2OH). d. Folin–Ciocalteu reagent chloroform (CHCl3). e. Sodium carbonate (Na2CO3). f. Gentaminice and fluconazole. g. Gallic acid and (þ)-catechin. h. The bovine testicular hyaluronidase (350 units). i. Potassium salt of human umbilical cord hyalur- onic acid. j. The culture mediums. k. The TTC solution (235-Triphenyl-2H-tetrazo- lium chloride). l. High purity water (18MX cm) and other chemicals. 19.2.2.2. Procedure. 1. Yeast cells (D7 diploid strain of Saccharomyces cerevi- siae ATCC 201137), according Pascoal et al. (2014). 2. Prior to each experiment the S. cerevisiae D7 strain must be tested for the frequency of spontaneous con- vertants at the tryptophan (trp) locus and revertants at the isoleucine (ilv) locus. 3. Cells from a culture with low spontaneous gene con- version and reverse point mutation frequencies were grown in a liquid medium at 28 C until they reached the stationary growth phase. 4. Yeast cells pelleted and re-suspended in a volume of 0.1 M sterile potassium phosphate buffer, pH 7.4, to obtain a final mixture of 2 108 cell/ml. 5. The mixture (4ml) contain 1ml of cell suspension, potassium phosphate buffer and methanolic extracts of BP, in order to reach final concentrations of 0.00, 0.25, 0.50 and 0.75mg/L. 6. Incubate the mixture under shaking for 2 h at 37 C. 94 M. G. Campos et al. 7. Cells are plated in complete and selective media to ascertain survival, trp convertants and ilv revertants. 8. Ethyl methanesulfonate (EMS), a mutagenic compound, is used as control. 19.2.3. Anti-mutagenic activities of BP in vivo 19.2.3.1. Materials and reagents. a. BP. b. Cis-platin (CDDP) (cis-diamminedicholorplatinum). c. Ethyl methanesulfonate (EMS) and other chemicals. 19.2.3.2. Experimental animals. For animal experimen- tation, we recommend to proceed according to the Guide for the Care and Use of Laboratory Animals Eighth Edition (2011) in order to perform as per inter- national ethical standards. The used animals are usually mice (Abdella et al., 2009; Tohamy et al., 2014). 19.2.3.3. Preparation of BP extracts. The preparation of BP extract can be according with Orsolic et al. (2005), Yamaguchi et al. (2007), Abdella et al. (2009) and Tohamy et al. (2014). Procedure 1. BP (280mg) was suspended in 10ml of distilled water. 2. Mix vigorously. 3. Keep the suspension overnight in dark. 4. Centrifuge at 10,000 rpm in a cooling centrifuge for 45minutes at 10 C. 5. Collect and filtrate the supernatant fraction. 6. Keep the filtrated in freeze condition at 20 C until use. 19.3. Concluding remarks on anti-mutagenic effects of BP Studies published by Pinto et al. (2010) suggest that some BP preparations could be employed as future chemopro- tective and/or chemopreventive agents, especially for mam- mary or other estrogen-dependent cancers because in their studies found that at least one preparation of both species showed a marked anti-genotoxic effect against the action of tested anticancer drug. These anti-mutagenic properties of BP have been attributed to their composition rich in phenolic compounds that justify the higher protec- tion (Pinto et al., 2010). This author also reported that the most effective species of BP from Salix alba in inducing inhibitory activity of E2 (17b-estradiol) and protected against the three mutagenic drugs and these results could be due its higher flavonoid content. Some of two studied samples were rich in luteolin, quercetin, chrysin, and kaempferol compounds that have been previously demon- strated to be antiestrogenic (Oh & Chung, 2006; Pinto et al., 2008; van Meeuwen et al., 2007), also exhibit anti- mutagenic and genotoxic activity (Lautraite et al., 2002; Nagy et al., 2009) whereas Galangin, pinocembrin and chrysin, as well as isorhamnetin 3-O-neohesperidoside, a derivative of isorhamnetin were proven to effectively con- trast the DNA-damaging activity of several mutagens/carci- nogens without exhibiting any genotoxic activity (Heo et al., 2001; Snyder & Gillies, 2002). Similar studies revealed that phenolic and flavonoids compounds as luteolin, chrysin, quercetin and taxifolin showed anti-mutagenic and genotoxic activity (Benkovic et al., 2008; Dutta et al., 2007; Makena et al., 2009; Uhl et al., 2003). Therefore, the anti- mutagenic effects, can be affected by total phenolic com- pound content as well as variation in their composition, and the higher phenolic compound content found in S. alba would justify the higher protection elicited toward the mutagenic drugs (Pinto et al., 2010). The specific mechanism of protection of the BP extract is reported to involve the scavenging of potentially toxic and mutagenic electrophiles and free radicals and the modi- fication of antioxidant pathways (Ohta et al., 2007). By another side, Nagy et al. (2009) referred that the anti- mutagenic effect of most phenolic compounds could be clearly ascribed to their -DPPH (1,1-diphenyl-2-picrylhy- drazyl) scavenging activity, substitution patterns and lipo- philicity. Barzin et al. (2011) in their studies evaluated the anti-mutagenic effects of pollen grams of Phoenix dactylifera using Ames assay and found that had 46% anti-mutagenic response. According to Ames et al. (1973, 1976) when the percent (46% of anti-mutagenic response), is more than 40, mutagenesis effect of the test sample is strong. Also, Bariliak et al. (1996) observed the ability of apiculture prod- ucts to decrease the mutagenic effects of some chemical and physical mutagens. In general way, the bioactivity of the pollens has been reported to be due to presence of com- pounds such as proteins, carbohydrates, amino acids, lipids, vitamins carotenoids, steroids, terpenes, flavonoids and polyphenols (Leja et al., 2007; Kao et al., 2020; Kroyer & Hegedus, 2001). Acknowledgements The COLOSS (Prevention of honey bee COlony LOSSes) Association aims to explain and prevent massive honey bee colony losses. It was funded through the COST Action FA0803. COST (European Cooperation in Science and Technology) is a unique means for European researchers to jointly develop their own ideas and new initiatives across all scientific disciplines through trans-European networking of nationally funded research activities. Based on a pan-European intergovernmental framework for cooperation in science and technology, COST has contributed since its creation more than 40 years ago to closing the gap between science, policy makers and society throughout Europe and beyond. COST is supported by the EU Seventh Framework Program for research, technological development and demonstration activ- ities (Official Journal L 412, 30 December 2006). The European Science Foundation as implementing agent of COST provides the COST Office through an EC Grant Agreement. The Council of the European Union provides the COST Secretariat. The COLOSS network is now supported by the Ricola Foundation – Nature & Culture. Figures 26–28 are reproduced from Sawyer (1981) with the permission of the publishers University College Cardiff Press and Northern Bee Standard methods for pollen research 95 Books. Lidia Barreto and J Nordi wish to thank the Apiculture Research Center of Taubate University (UNITAU-SP/Brazil) and Agriculture Secretary of Bahia State (SEAGRI-BA/ BRAZIL). Maria Campos wishes to thank (UI0204): UIDB/ 00313/2020, Center of Chemistry from Faculty of Sciences and Technology of University of Coimbra, Portugal. Ofelia Anjos wishes to thank to Forest Research Centre, a research unit funded by Fundac¸~ao para a Cie^ncia e a Tecnologia I.P. (FCT), Portugal (UIDB/00239/2020), and to Centro de Biotecnologia de Plantas da Beira Interior for the OPUS soft- ware availability. Norma Almaraz Abarca thanks to the Instituto Politecnico Nacional for financial and logistic support. Manuel Chica and Pascual Campoy wish to thank the APIFRESH project. APIFRESH has been co-funded by the European Commission under the R4SMEs 7th Framework Program. Olena Lokutova thanks the Austrian Institute of bee- keeping, Dr H Pehhacker and the same members of the Institute H Hagel and E H€uttinger for conducting photo- microscopic studies and pollen analysis Ukrainian samples of pollen loads, which were the basis of the atlas of pollen “honey plants” of Ukraine. Olena is grateful also to Polish col- leagues Z Warakomska (Department of Botany University of Lublin) and D Teper (Polish Institute of beekeeping) for their professionalism and consultations to determine the botanical origin of some Ukrainian honey. Also thanks to their scientific advisers’ academician G Bogdanov (National Academy of Agrarian Sciences of Ukraine), Prof. V Polishuk (Department of beekeeping National University of Life and Environmental Sciences of Ukraine) and O Martynyuk (M.G. Kholodny Institute of Botany, Kiev, Ukraine) for his helpful co-operation in the field of beekeeping and palinology. Janka Nozkova wishes to thank the Operational Program Research and Development of the European Regional Development Fund in the frame of the project “Support of technologies innovation for special bio-food products for human healthy nutrition” (ITMS 26220220115) and also by the Excellence Center for Agrobiodiversity Conservation and Benefit – project imple- mented under the Operational Program Research and Development financed by European Fund for Regional Development ITMS 26220120015 (Slovak Republic) and all colleagues from Institute of Biodiversity and Biosafety, Slovak University of Agriculture in Nitra for their help with image analysis. Ananias Pascoal, Georgina Tolentino and Letıcia Estevinho would like to thank Fundac¸~ao para a Cie^ncia e Tecnologia (FCT), Programa Operacional Pontencial Humano (POPH) and European Union (EU) for his Postdoctoral grant SFRH/BPD/91380/2012. Wiebke Sickel, Markus Ankenbrand, Gudrun Grimmer, Frank F€orster, Ingolf Steffan-Dewenter and Alexander Keller thank the financial support by the DFG Collaborative Research Center 1047, Insect Timing. MJA was further supported by a grant of the German Excellence Initiative to the Graduate School of Life Sciences of the University of W€urzburg. They are grateful to the members of the Departments of Animal Ecology and Tropical Biology; Bioinformatics; and Human Genetics, University of W€urzburg, for constructive input on the design of the workflow. Additionally thank to the Department of Human Genetics, especially S. Rost, for granting access to the Illumina MiSeq device. Zivoslav Tesic, Mirjana Mosic, Aleksandar Kostic, Mirjana Pesic, Dusanka Milojkovic-Opsenica thank the Ministry of Education, Science and Technological Development of Serbia, Grants 172017 and TR 31069. Gina Tolentino would like to thank the Mountain Research Center (CIMO), Agricultural College of Braganc¸a, Polytechnic Institute of Braganc¸a for his research grant in the project titled " Development of new bee products in biological produc- tion way.” Disclosure statement No potential conflict of interest was reported by the authors. ORCID Maria G. Campos http://orcid.org/0000-0003-1012-6240 Ofelia Anjos http://orcid.org/0000-0003-0267-3252 Manuel Chica http://orcid.org/0000-0002-4717-1056 Pascual Campoy http://orcid.org/0000-0002-9894-2009 Norma Almaraz-Abarca http://orcid.org/0000-0003- 1603-4865 Leticia M. Estevinho http://orcid.org/0000-0002-9249-1948 Ananias Pascoal http://orcid.org/0000-0003-3823-0402 Luis G. Dias http://orcid.org/0000-0002-1210-4259 Zivoslav L. j. Tesic http://orcid.org/0000-0002-5162-3123 Aleksandar Z. Kostic http://orcid.org/0000-0002-1012-4029 Mirjana B. Pesic http://orcid.org/0000-0001-9779-1686 Dusanka M. Milojkovic-Opsenica http://orcid.org/0000-0001- 6274-4222 Wiebke Sickel http://orcid.org/0000-0002-0038-1478 Markus J. Ankenbrand http://orcid.org/0000-0002- 6620-807X Ingolf Steffan-Dewenter http://orcid.org/0000-0003- 1359-3944 Alexander Keller http://orcid.org/0000-0001-5716-3634 Frank F€orster http://orcid.org/0000-0003-4166-5423 Chrysoula H. Tananaki http://orcid.org/0000-0002- 0056-483X Vasilios Liolios http://orcid.org/0000-0001-7353-2364 Dimitrios Kanelis http://orcid.org/0000-0001-7736-4783 Maria-Anna Rodopoulou http://orcid.org/0000-0003- 1643-4615 Andreas Thrasyvoulou http://orcid.org/0000-0001-6731-4184 Christina Kast http://orcid.org/0000-0002-5673-6848 Ligia Bicudo de Almeida-Muradian http://orcid.org/0000- 0001-5322-1358 Teresa SzczeR sna http://orcid.org/0000-0002-0161-0287 Norman L. Carreck http://orcid.org/0000-0001-7779-9736 References Abdella, E. M., Tohamy, A., & Ahmad, R.R. (2009). Antimutagenic activity of Egyptian propolis and bee pollen water extracts against cisplatin-induced chromosomal abnormalities in bone marrow cells of mice. Iranian Journal of Cancer Prevention, 2(4), 175–181. Abouda, Z., Zerdani, I., Kalalou, I., Faid, M., & Ahami, M. T. (2011). The antibacterial activity of Moroccan bee bread and bee-pollen (fresh and dried) against pathogenic bacteria. Research Journal of Microbiology, 6(4), 376. http://.dx.doi.org/ 10.3923/jm.2011.376.384 Akkol, E. K., Orhan, D. D., Gurbuz, I., & Yesilada, E. (2010). In vivo activity assessment of a "honey-bee pollen mix" for- mulation. Pharmaceutical Biology, 48(3), 253–259. https://doi. org/10.3109/13880200903085482 Allen, G. (2006). An automated pollen recognition system [Master’s thesis]. Institute of information Sciences and Technology, Massey University. Almaraz-Abarca, N., Campos, M. d. G., Avila-Reyes, J. A., Naranjo-Jimenez, N., Herrera-Corral, J., & Gonzalez, V. L. S. (2004). Variability of antioxidant activity among honey bee-collected pollen of different botanical origin. Interciencia, 29(10), 574–578. doi: 0378-1844/04/10/574-05. Almaraz-Abarca, N., Campos, M. D. G., Delgado-Alvarado, A., Avila-Reyes, J. A., Naranjo-Jimenez, J. A., & Herrera Corral, H. (2006). Variacion intrapoblacional en el Perfil Fenolico 96 M. G. Campos et al. del polen de Stenocactus multicostatus subsp. zacatecasensis (Cactaceae). Boletın Nakari, 17(3), 59–64. Almaraz-Abarca, N., Campos, M. G., Avila-Reyes, J. A., Naranjo-Jimenez, N., Herrera Corral, J., & Gonzalez-Valdez, L. S. (2007). Antioxidant activity of polyphenolic extract of monofloral honey bee – collected pollen from mesquite (Prosopis juliflora, Leguminosae). Journal of Food Composition and Analysis, 20(2), 119–124. https://doi.org/10.1016/j.jfca. 2006.08.001 Almaraz-Abarca, N., Campos, M. G., Delgado-Alvarado, A., Avila-Reyes, J. A., Naranjo-Jimenez, N., Herrera Corral, J., Tomatas, A. F., Almeida, A. J., & Vieira, A. (2007). Fenoles del polen de Stenocactus, Echinocereus y Mammillaria (Cactaceae). Polibotanica, 23, 37–55. http://www.herbario. encb.ipn.mx/pb/pdf/pb23/3Fenoles.pdf Almaraz-Abarca, N., Campos, M. G., Delgado-Alvarado, E. A., Avila-Reyes, J. A., Herrera-Corral, J., Gonzalez-Valdez, L. S., Naranjo-Jimenez, N., Frigerio, C., Tomatas, A. F., Almeida, A. J., Vieira, A., & Uribe-Soto, J. N. (2008). Pollen flavonoid/ phenolic acid composition of four species of Cactaceae and its taxonomic significance. American Journal of Agricultural and Biological Science, 3(3), 534–543. https://doi.org/10.3844/ ajabssp.2008.534.543 Almaraz-Abarca, N., Gonzalez-Elizondo, M. S., Campos, M. G., Avila-Sevilla, Z. E., Delgado-Alvarado, E. A., & Avila, R. J. A. (2013). Variability of the foliar phenol profiles of Agave vic- toriae-reginae complex (Agavaceae). Botanical Sciences, 91(3), 295–306. https://doi.org/10.17129/botsci.9 Almaraz-Abarca, N., Rivera-Rodrıguez, D. M., Arraez-Roman, D., Segura-Carretero, A., Sanchez-Gonzalez, J. J., Delgado- Alvarado, A., Avila-Reyes, J. A. (2013). Los fenoles del polen del genero Zea. Acta Botanica Mexicana, 105, 59–85. http://www.ibiologia.unam.mx/sociedad/www/pdf/BSBM91_ 3/Almaraz-Abarca_91_3_295-306.pdf Almeida-Muradian, L. B., Arruda, V. A. S., & Barreto, L. M. R. C. (2012). Manual de Controle de Qualidade do Polen Apıcola (p. 28). APACAME. Almeida-Muradian, L. B., Pamplona, L. C., Coimbra, S., & Barth, O. M. (2005). Chemical composition and botanical evaluation of dried bee pollen pellets. Journal of Food Composition and Analysis, 18(1), 105–111. https://doi.org/10. 1016/j.jfca.2003.10.008 Aly, M. S., Ashour, M. B., EL-Nahas, S. M., & Abo Zeid, M. A. F. (2003). Genotoxicity and cytotoxicity of the anti- cancer drugs gemcitabine and cisplatin, separately and in comination: in vivo studies. Journal of Biological Sciences, 3(11), 961–972. https://doi.org/10.3923/jbs.2003.961. 972[Mismatch] . Ambruster, L., & Oenike, G. (1929). Die pollenformen als mittel zur honig herkunftsbestimmung (p. 116). Wachholtz. Ames, B. N., Durston, W. E., Yamasaki, E., & Lee, F. D. (1973). Carcinogens are mutagens: A simple test system combining liver homogenates for activation and bacteria for detection. Proceedings of the National Academy of Sciences of the United States of America, 70(8), 2281–2285. https://doi. org/10.1128/AAC.04918-14. Andrada, A. C., & Telleria, M. C. (2005). Pollen collected by honey bees (Apis mellifera L.) from south of Calden district (Argentina): Botanical origin and protein content. Grana, 44(2), 115–122. https://doi.org/10.1080/00173130510010459 Anjos, O., Campos, M. G., Ruiz, P. C., & Antunes, P. (2015). Application of FTIR-ATR spectroscopy to the quantification of sugar in honey. Food Chemistry, 169, 218–223. https://doi. org/10.1016/j.foodchem.2014.07.138 Anjos, O., Santos, A. J. A., Dias, T., Estevinho, L. M. (2017). Application of FTIR-ATR Spectroscopy on the bee pollen characterization. Journal of Apicultural Research, 56(3), 210–218. https://doi.org/10.1080/00218839.2017.1289657 Anjos, O., Santos, A. F. A., Paix~ao, V., Estevinho, M. L. (2018). Physicochemical Parameters of Lavandula spp. honey accessed by FT-RAMAN. Talanta, 178, 43–48. https://doi. org/10.1016/j.talanta.2017.08.099 Ankenbrand, M. J. (2015). The ITS2 Database V – Twice as much. Molecular Biology and Evolution, 32, 3030–3032. AOAC. (1995). Official methods of analysis (16th Ed.). Association of Official Analytical Chemists. Arroyo, J., Devesa, J. A., Herrera, P., Ortiz, P. L., & Lozano, S. T. (1986). Resumen del proyecto de investigacion: La flora melitofila en Andalucıa occidental. Vida Apıcola, 18, 33–39. Arruda, V. A. S. (2013). Dried bee pollen: Physicochemical, micro- biological quality, phenolic and flavonoid compounds, antioxidant activity and botanical origin [PhD thesis]. Pharmaceutical Science School, University of S~ao Paulo. Arruda, V. A. S., Freitas, A. S., B., O. M., Estevinho, L. M., & Almeida-Muradian, L. B. (2013). Propriedades biologicas do polen apıcola de coqueiro, coletado na Regi~ao Nordeste do Brasil. Magistra, 25, 1–6. Arruda, V. A. S., Santos Pereira, A. A., de Freitas, A. S., Barth, O. M., & de Almeida-Muradian, L. B. (2013b). Dried bee pollen: B complex vitamins, physicochemical and botanical composition. Journal of Food Composition and Analysis, 29(2), 100–105. https://doi.org/10.1016/j.jfca.2012.11.004 Arruda, V. A. S., Santos Pereira, A. A., Estevinho, L. M., & de Almeida-Muradian, L. B. (2013a). Presence and stability of B complex vitamins in bee pollen using different storage con- ditions. Food and Chemical Toxicology, 51, 143–148. https:// doi.org/10.1016/j.fct.2012.09.019 Avula, B., Satyanarayanaraju, S., Wang, Y., Zweigenbaum, J., Wang, M., & Khan, I. A. (2015). Characterization and screening of pyrrolizidine alkaloids and N-oxides from bota- nicals and dietary supplements using UHPLC-high resolution mass spectrometry. Food Chemistry, 178, 136–148. https:// doi.org/10.1016/j.foodchem.2015.01.053 Balkanska, R. G., Ignatova, M. M. (2012). Chemical composition of multifloral bee pollen from Bulgaria. In Proceedings of 6th Central European Congress on Food, CE Food 2012 (pp. 375–378). Ball, G. (1998). Bioavailability and analysis of vitamins in foods. Chapman & Hall. Baltrusaityt _e, V., Venskutonis, P. R., & Ceksteryt _e, V. (2007b). Radical scavenging activity of different floral origin honey and beebread phenolic extracts. Food Chemistry, 101(2), 502–514. https://doi.org/10.1016/j.foodchem.2006.02.007 Barbosa, S. I. T. R., Silvestre, A. J. D., Sim~oes, M. M. Q., & Estevinho, M. L. (2006). Composition and antibacterial activity of the lipophilic fraction of honey bee pollen from native species of Montesinho Natural Park. International Journal of Agricultural Research, 1(5), 471–749. Bariliak, I. R., Berdyshev, G. D., & Dugan, A. M. (1996). The antimutagenic action of apiculture products. The Journal of Cytology and Genetics, 30, 48–55. Barreto, L. M. R. C. (2004). Polen Apıcola: beneficiamento, armazenamento e legislac¸~ao. Botucatu, 2004, 150 (Tese Doutorado) – Faculdade de Medicina Veterinaria e Zootecnia – Universidade Estadual Paulista. Barreto, L. M. R. C., Dib, A. P. S., & Pe~ao, G. F. R. (2006). Higienizac¸~ao e Sanitizac¸~ao da Produc¸~ao Apıcola (p. 150). Cabral Editora e Livraria Universitaria. Barreto, L. M. R. C., Funari, S. R. C., Orsi, R. O., & Dib, A. P. S. (2006). Produc¸~ao de Polen no Brasil (p. 100). Cabral Editora e Livraria Universitaria. Barriada-Bernal, L. G., Almaraz-Abarca, N., Delgado-Alvarado, E. A., Gallardo-Velazquez, T., Avila-Reyes, J. A., Torres-Moran, M. I., Gonzalez-Elizondo, M. d. S., & Herrera-Arrieta, Y. (2014). Flavonoid composition and antioxidant capacity of the edible flowers of Agave durangensis (Agavaceae). Cyta – Journal of Food, 12(2), 105–114. https://doi.org/10.1080/19476337.2013.801037 Standard methods for pollen research 97 Barry, A. L., & Thornsberry, C. (1991). Susceptibility tests: Diffusion test procedures. In A. Balows, W. J. Hauser, K. L. Hermann, H. D. Isenberg, & H. J. Shamody (Eds.),Manual of clin- ical microbiology (Vol. 5, pp. 1117–1125). American Society for Microbiology. Barth, O. M. (2004). Melissopalynology in Brazil: A review of pollen analysis of honeys, propolis and pollen loads of bees. Scientia Agricola, 61(3), 342–350. https://doi.org/10.1590/ S0103-90162004000300018 Barth, O. M., Freitas, A. S., Oliveira, E. S., Silva, R. A., Maester, F. M., Andrella, R. R., & Cardozo, G. M. (2010). Evaluation of the botanical origin of commercial dry bee pollen load batches using pollen analysis: A proposal for technical standardization. Anais da Academia Brasileira de Ciencias, 82(4), 893–902. https://doi.org/10.1590/s0001- 37652010000400011 Barzin, G., Entezari, M., Hashemi, M., Hajiali, S., Ghafoori., & Gholami, M. (2011). Survey of Antimutagenicity and Anticancer effect of Phoenix dactylifera pollen grains. Advances in Environmental Biology, 5(12), 3716–3718. Basim, E., Basim, H., & Ozcan, M. (2006). Antibacterial activ- ities of Turkish pollen and propolis extracts against plant bacterial pathogens. Journal of Food Engineering, 77(4), 992–996. https://doi.org/10.1016/j.jfoodeng.2005.08.027 Bassi, E. A. (2000). Programa de qualidade total na produc¸~ao de mel. In: Congresso brasileiro de apicultura, 13, 2000. Sonopress. 1CD. Basuny, A. M., Arafat, S. M., & Soliman, H. M. (2013). Chemical analysis of olive and palm pollen: Antioxidant and antimicrobial activation properties. Herald Journal of Agriculture and Food Science Research, 2(3), 091–097. Bell, K. L., Burgess, K. S., Botsch, J. C., Dobbs, E. K., Read, T. D., & Brosi, B. J. (2019). Quantitative and qualitative assess- ment of pollen DNA metabarcoding using constructed spe- cies mixtures. Molecular Ecology, 28, 431–455. https://doi. org/10.1111/mec.14840. Benkovic, V., Knezevic, A. H., Dikic, D., Lisicic, D., Orsolic, N., Basic, I., Kosalec, I., & Kopjar, N. (2008). Radioprotective effects of propolis and quercetin in gamma-irradiated mice evaluated by the alkaline comet assay. Phytomedicine, 15(10), 851–858. https://doi.org/10.1016/j.phymed.2008.02.010 Bertoncelj, J., Polak, T., Kropf, U., Korosec, M., & Golob, T. (2011). LC-DAD-ESI/MS analysis of flavonoids and abscisic acid with chemometric approach for the classification of Slovenian honey. Food Chemistry, 127(1), 296–302. https:// doi.org/10.1016/j.foodchem.2011.01.003 Bessonov, V. N. (1992). Status of pollen as an indicator of pol- lution by heavy metals. Ecology. – Ekaterinburg, 1992(3), 45–50. (Article in Russian). Betteridge, K., Cao, Y., & Colegate, S. M. (2005). Improved method for extraction and LC-MS analysis of pyrrolizidine alka- loids and their N-oxides in honey: Application to Echium vulgare honeys. Journal of Agricultural and Food Chemistry, 53(6), 1894–1902. https://doi.org/10.1021/jf0480952 Biesaga, M., & Pyrzynska, K. (2009). Liquid chromatography/ tandem mass spectrometry studies of the phenolic com- pounds in honey. Journal of Chromatography. A, 1216(38), 6620–6626. https://doi.org/10.1016/j.chroma.2009.07.066 Biodiversity International. (2007). Guidelines for the development of crop descriptor lists. Biodiversity Technical Bulletin Series (xii þ 72 pp.). Biodiversity International. Bobis, O., Marghitas, L., Al, Dezmirean, D., Morar, O., Bonta, V., & Chirila, F. (2010). Quality parameters and nutritional value of different commercial bee products. Bulletin UASVM Animal Science and Biotechnologies, 67(1-2), 91–96. Bogdanov, S. (2015). Pollen: Production, nutrition and health: A review. Bee Product Science. www.bee-hexagon.net Bogdanov, S., Martin, P., & L€ullmann, C. (1997). Harmonized methods of the European Honey Commission. Determination of sugars by HPLC. Apidologie, 28, 42–44. Bondet, V., Brand-Williams, W., & Berset, C. (1997). Kinetics and mechanisms of antioxidant activity using the DPPH free radical method. LWT – Food Science and Technology, 30(6), 609–615. https://doi.org/10.1006/fstl.1997.0240 Boppre, M. (2011). The ecological context of pyrrolizidine alkaloids in food, feed and forage: An overview. Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment, 28(3), 260–281. https://doi.org/ 10.1080/19440049.2011.555085 Boppre, M., Colegate, S. M., & Edgar, J. A. (2005). Pyrrolizidine alkaloids of Echium vulgare honey found in pure pollen. Journal of Agricultural and Food Chemistry, 53(3), 594–600. https://doi.org/10.1021/jf0484531 Boucher, A., Hidalgo, P. J., Thonnat, M., Belmonte, J., Galan, C., Bonton, P., & Tomczak, R. (2002). Development of a semi-automatic system for pollen recognition. Aerobiologia, 18(3/4), 195–201. https://doi.org/10.1023/A:1021322813565 Boudet, A. M. (2007). Evolution and current status of research in phenolic compounds. Phytochemistry, 68(22-24), 2722–2735. https://doi.org/10.1016/j.phytochem.2007.06.012 Brasil. (1997). Ministerio da Agricultura e do Abastecimento. Portaria no 368, de 4 de setembro de 1997. Regulamento Tecnico sobre as Condic¸~oes Higie^nico-Sanitarias e de Boas Praticas de Elaborac¸~ao para Estabelecimentos Elaboradores/ Industrializadores de Alimentos. Diario Oficial da Uni~ao da Republica Federativa do Brasil, Brasılia. Brasil. (2001). Instruc¸~ao Normativa do Ministerio da Agricultura n 3, de 19 de janeiro de 2001. (DOU – 23/01/ 01, Secc¸~ao I, pg. 18-23) Regulamentos tecnicos de identi- dade e qualidade de apitoxina, cera de abelhas, geleia real, geleia real Liofilizada, polen apıcola, propolis e extrato de propolis. Diario Ofıcial (DO), Brasılia, DF. Brindza, J., & Brovarskyi, V. (2014). Pollen and bee pollen of some plant species (p. 138). Kyiv: Korsunskiy vidavnichiy dim Vsesvit. Bruni, I., Galimberti, A., Caridi, L., Scaccabarozzi, D., De Mattia, F., Casiraghi, M., & Labra, M. (2015). A DNA bar- coding approach to identify plant species in multiflower honey. Food Chemistry, 170, 308–315. https://doi.org/10. 1016/j.foodchem.2014.08.060 Bucher, E., Rjfler, V., Vorwoht, G., & Zieger, E. (2004). Das pollebild der sudtiroler honige (p. 676). Biologischer labor. Burmistrov, N., & Nikitina, V. A. (1990). Honey plants and their pollen (p. 192). Rosagropromizdat. (Book on Russian). Cabrera, C., & Montenegro, G. (2013). Pathogen control using a natural Chilean bee pollen extract of known botanical ori- gin. Ciencia e Investigacion Agraria, 40(1), 223–230. https:// doi.org/10.4067/S0718-16202013000100020 Campos, M. G. (1997). Caracterizac¸~ao do polen apıcola pelo seu perfil em compostos fenolicos e pesquisa de algumas actividades biologicas [PhD thesis]. Faculty of Pharmacy, University of Coimbra. Campos, M. G., Bogdanov, S., Almeida-Muradian, L. B., Szczesna, T., Mancebo, Y., Frigerio, C., & Ferreira, F. (2008). Pollen composition and standardization of analytical methods. Journal of Apicultural Research, 47(2), 154–161. https://doi.org/10.3896/IBRA.1.47.2.12[10.1080/00218839. 2008.11101443] Campos, M. G., Frigerio, C., Lopes, J., & Bogdanov, S. (2010). What is the future of bee pollen? Journal of ApiProduct and ApiMedical Science, 2(4), 131–144. https://doi.org/10.3896/ IBRA.4.02.4.01 Campos, M. G., & Markham, K. R. (2007). Structure information from HPLC and on-line measured absorption spectra: Flavones, flavonols and phenolic acids. Imprensa da Universidade de Coimbra. https://doi.org/10.14195/978-989-26-0480-0 98 M. G. Campos et al. Campos, M. G., Markham, K. R., Mitchell, K. A, & da Cunha, A. P. d. (1997). An approach to the characterization of bee pollens via their flavonoid/phenolic profiles. Phytochemical Analysis, 8(4), 181–185. https://doi.org/10.1002/(SICI)1099- 1565(199707)8:4< 181::AID-PCA359> 3.0.CO;2-A Campos, M. G., Markham, K., & Proenc¸a da Cunha, A. (1996). Quality assessment of bee-pollens using flavonoid/phenolic profiles. Bull. Groupe Polyphenols, 18, 54–55. Campos, M. G., Mitchel, K., Cunha, A., & Markham, K. R. (1997). A systematic approach to the characterization of bee pollens via their flavonoid/phenolic profiles. Phytochemical Analysis, 8(4), 181–185. 2-A https://doi.org/10. 1002/(SICI)1099-1565(199707)8:4< 181::AID-PCA359> 3. 0.CO,[10.1002/(SICI)1099-1565(199707)8:4< 181::AID- PCA359> 3.0.CO;2-A] Campos, M. G., Webby, R. F., Markham, K. R., Mitchell, K. A., & da Cunha, A. P. (2003). Age-induced diminution of free radical scavenging capacity in bee pollens and the contribu- tion of constituent flavonoids. Journal of Agricultural and Food Chemistry, 51(3), 742–745. https://doi.org/10.1021/jf0206466 Caroli, S., Forte, G., Iamiceli, A. L., & Galoppi, B. (1999). Determination of essential and potentially toxic trace ele- ments in honey by inductively coupled plasma-based techni- ques. Talanta, 50(2), 327–336. https://doi.org/10.1016/ S0039-9140(99)00025-9 Carpes, S. T., Begnini, R., DE Alencar, S. M., & Masson, M. L. (2007). Study of preparations of bee pollen extracts, anti- oxidant and antibacterial activity. Ci^encia e Agrotecnologia, 31(6), 1818–1825. https://doi.org/10.1590/S1413- 70542007000600032 Carpes, S. T., Prado, A. P., Moreno, I. A. M., Mour~ao, G. B., DE Alencar, S. M., & Masson, M. L. (2008). Avaliac¸~ao do potencial antioxidante do polen apıcola producido na regi~ao sul do Brasil. Quımica Nova, 31(7), 1660–1664. https://doi. org/10.1590/S0100-40422008000700011 Carrion, P., Cernadas, E., Galvez, J. F., & Dıaz-Losada, E. (2003). Determine the composition of honey bee pollen by texture classification. In F. J. Perales (Ed.), IbPRIA 2003, LNCS 2652 (pp. 158–167). https://doi.org/10.1007/978-3- 540-44871-6_19 Carvell, C., Westrich, P., Meek, W. R., Pywell, R. F., & Nowakowski, M. (2006). Assessing the value of annual and perennial forage mixtures for bumble bees by direct obser- vation and pollen analysis. Apidologie, 37(3), 326–340. https://doi.org/10.1051/apido:2006002 Cavalieri, S. J., Harbeck, R. J., Mccarter, Y. S., Ortez, J. H., Rankin, I. D., Sautter, R. L., Sharp, S. E., & Spiegel, C. A. (2005). Manual of antimicrobial susceptibility testing. In M. B. Coyle (Ed.), American Society for Microbiology # 2005 (pp. 1–236). American Society for Microbiology. Chandola, V., Banerjee, A., & Kumar, V. (2009). Anomaly detection: A survey. ACM Computing Surveys, 41(3), 1–15. 58. https://doi.org/10.1145/1541880.1541882 Chantarudee, A., Phuwapraisirian, P., Kimura, K., Okuyama, M., Mori, H., Kimura, A., & Chanchao, C. (2012). Chemical constituents and free radical scavenging activity of corn pol- len collected from Apis mellifera hives compared to floral corn pollen at Nam, Thailand. BMC Complementary & Alternative Medicine, 12, 45. Chaturvedi, M. (1973). An analysis of honey bee pollen loads from Banthra, Lucknow, India. Grana, 13(3), 139–144. https://doi.org/10.1080/00173137309429890 Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang, X., Luo, K., Li, Y., Li, X., Jia, X., Lin, Y., & Leon, C. (2010). Validation of the ITS2 region as a novel DNA bar- code for identifying medicinal plant species. PLoS One, 5(1), e8613. https://doi.org/10.1371/journal.pone.0008613 Chica, M., & Campoy, P. (2012). Discernment of bee pollen loads using computer vision and one-class classification techniques. Journal of Food Engineering, 112(1-2), 50–59. https://doi.org/10.1016/j.jfoodeng.2012.03.028 Choi, E. (2007). Antinociceptive and antiinflammatory activities of pine (Pinus densiflora) pollen extract. Phytotherapy Research, 21(5), 471–475. https://doi.org/10.1002/ptr.2103 Chudzinska, M., & Baralkiewicz, D. (2011). Application of ICP- MS method of determination of 15 elements in honey with chemometric approach for the verification of their authenti- city. Food and Chemical Toxicology, 49(11), 2741–2749. https://doi.org/10.1016/j.fct.2011.08.014 Cirnu, I., Slusanschi, N., Maronescu, R., Filipescu, H., & Grosu, E. (1969). Compozitia chimica a polenului de porumb (Zea mays L.) si floarea-soarelui (Helianthus annuus L.) recoltat la diferite epoci, in cardul amestecului furajer-melifer. Apicultura, 22(8), 22–25. Clinical and Laboratory Standards Institute (CLSI). (2009). Performance standards for antimicrobial disk susceptibility tests; approved standard-tenth edition M02-A10. National Committee for Clinical Laboratory Standards, 29. 76 pp Clinical and Laboratory Standards Institute (CLSI). (2012). Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard – Ninth Edition M07 – A9. National Committee for Clinical Laboratory Standards, 32(2), 1–64. Comaniciu, D., & Meer, P. (2002). Mean shift: A robust approach toward feature space analysis. IEEE Transactions on Pattern Analysis and Machine Intelligence, 24(5), 603–619. https://doi.org/10.1109/34.1000236 Costa, C. T., Dalluge, J. J., Welch, M. J., Coxon, B., Margolis, S. A., & Horton, D. (2000). Characterization of prenylated xanthones and flavanones by liquid chromatography/atmos- pheric pressure chemical ionization mass spectrometry. Journal of Mass Spectrometry, 35(4), 540–549. https://doi.org/ 10.1002/(SICI)1096-9888(200004)35:4< 540:: AID-JMS966> 3.0.CO;2-Y Crane, E. E. (1990). Bees and beekeeping: Science, practice and world resources (p. 593). Cornstock Publ. Crews, C., Berthiller, F., & Krska, R. (2010). Update on analyt- ical methods for toxic pyrrolizidine alkaloids. Analytical and Bioanalytical Chemistry, 396(1), 327–338. https://doi.org/10. 1007/s00216-009-3092-2 Crews, C., Driffield, M., Berthiller, F., & Krska, R. (2009). Loss of pyrrolizidine alkaloids on decomposition of ragwort (Senecio jacobaea) as measured by LC-TOF-MS. Journal of Agricultural and Food Chemistry, 57(9), 3669–3673. https:// doi.org/10.1021/jf900226c Cuyckens, F., & Claeys, M. (2002). Optimization of a liquid chromatography method based on simultaneous electro- spray ionization mass spectrometric and ultraviolet photo- diode array detection for analysis of flavonoid glycosides. Rapid Communications in Mass Spectrometry, 16(24), 2341–2348. https://doi.org/10.1002/rcm.861 Cuyckens, F., & Claeys, M. (2004). Mass spectrometry in the structural analysis of flavonoids. Journal of Mass Spectrometry, 39(1), 1–15. https://doi.org/10.1002/jms.585 Danner, N., H€artel, S., & Steffan-Dewenter, I. (2014). Maize pollen foraging by honey bees in relation to crop area and landscape context. Basic and Applied Ecology, 15(8), 677–684. https://doi.org/10.1016/j.baae.2014.08.010 Dasarathy, B. (1991). Nearest Neighbor (NN) norms: Nearest neigh- bor pattern classification techniques. IEEE Computational Society. de Rijke, E., Out, P., Niessen, W. M. A., Ariese, F., Gooijer, C., & Brinkman, U. A. (2006). Analytical separation and detection methods for flavonoids. Journal of Chromatography. A, 1112(1-2), 31–63. https://doi.org/10.1016/j.chroma.2006. 01.019 de Rijke, E., Zappey, H., Ariese, F., Gooijer, C., & Brinkman, U. A. (2003). Liquid chromatography with atmospheric pressure chemical ionization and electrospray ionization Standard methods for pollen research 99 mass spectrometry of flavonoids with triple quadrupole and ion-trap instruments. Journal of Chromatography. A, 984(1), 45–58. https://doi.org/10.1016/S0021-9673(02)01868-X Delaplane, K. S., Dag, A., Danka, R. G., Freitas, B. M., Garibaldi, L. A., Goodwin, R. M., & Hormaza, J. I. (2013). Standard methods for pollination research with Apis melli- fera. In V. Dietemann, J. D. Ellis, & P. Neumann (Eds.), The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research, 52(4). https://doi.org/10.3896/IBRA.1.52.4.12. Di Paola-Naranjo, R. D., Sanchez, S. J., Paramas, A. M. G., & Rivas Gonzalo, J. C. (2004). Liquid chromatographic-mass spectrometric analysis of anthocyanin composition of dark blue bee pollen from Echium plantagineum. Journal of Chromatography. A, 1054(1-2), 205–210. https://doi.org/10. 1016/j.chroma.2004.05.023 Droussi, Z., D'orazio, V., Provenzano, M. R., Hafidi, M., & Ouatmane, A. (2009). Study of the biodegradation and transformation of olive-mill residues during composting using FTIR spectroscopy and differential scanning calorim- etry. Journal of Hazardous Materials, 164(2-3), 1281–1285. https://doi.org/10.1016/j.jhazmat.2008.09.081 D€ubecke, A., Beckh, G., & L€ullmann, C. (2011). Pyrrolizidine alkaloids in honey and bee pollen. Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment, 28(3), 348–358. https://doi.org/10.1080/ 19440049.2010.541594 Dustman, J. H. (1992). Honey, quality and its control. Abstracts of the 8th International Palynological Congress. France, p. 40. Dutkiewicz, S. (1996). Usefulness of Cernilton in the treatment of benign prostatic hyperplasia. International Urology and Nephrology, 28(1), 49–53. https://doi.org/10.1007/BF02550137 Dutta, D., Devi, S. S., Krishnamurthi, K., Kumar, K., Vyas, P., Muthal, P. L., Naoghare, P., & Chakrabarti, T. (2007). Modulatory effect of distillate of Ocimum sanctum leaf extract (Tulsi) on human lymphocytes against genotoxi- cants. Biomedical and Environmental Sciences, 20(3), 226–234. Dzyuba, O. F. (2006). Palinoindikatsiya environmental quality. SPb.: Publishing House "Nedra", 198 p. (Article in Russian). Dzyuba, O. F. (2007). Teratomorfnye pollen grains in a modern and paleopalinologicheskih pollen spectra and some problems. Palynostratigraphy/OF Dziuba//Oil and Gas Technologies: Theory and Practice, 2007(2), 1–22. (Article in Russian). Dzyuba, O. F., & Tarasovich, V. F. (2001). The morphological features of pollen grains of Tilia Cordata Mill. In the mod- ern metropolis. International Workshop: Pollen as an indi- cator of environmental and paleoecological reconstruction – St. Petersburg, pp. 79–90. (Article in Russian). Echigo, T., Takenaka, T., & Yatsunami, K. (1986). Comparative studies on chemical composition of honey, royal jelly and pollen loads. Bulletin of the Faculty of Agriculture Tamagawa University, 26, 1–8. Edgar, R. C. (2010). Search and clustering orders of magnitude faster than BLAST. Bioinformatics, 26(19), 2460–2461. https://doi.org/10.1093/bioinformatics/btq461 Eloff, J. N. (1998). A sensitive and quick microplate method to determine the minimal inhibitory concentration of plant extracts for bacteria. Planta Medica, 64(8), 711–713. https:// doi.org/10.1055/s-2006-957563 Eraslan, G., Kanbur, M., & Silici, S. (2009). Effect of carbaryl on some biochemical changes in rats: The ameliorative effect of bee pollen. Food and Chemical Toxicology, 47(1), 86–91. https://doi.org/10.1016/j.fct.2008.10.013 Eraslan, G., Kanbur, M., Silici, S., Liman, B., Altinordulu, S., & Sarica, Z. S. (2009). Evaluation of protective effect of bee pollen against propoxur toxicity in rat. Ecotoxicology and Environmental Safety, 72(3), 931–937. https://doi.org/10. 1016/j.ecoenv.2008.06.008 Erkmen, O., & Ozcan, M. M. (2008). Antimicrobial effects of Turkish propolis, pollen, and laurel on spoilage and patho- genic food-related microorganisms. Journal of Medicinal Food, 11(3), 587–592. https://doi.org/10.1089/jmf.2007.0038 Estevinho, L. M., Pereira, A. P., Moreira, L., Dias, L. G., & Pereira, E. (2008). Antioxidant and antimicrobial effects of phenolic compounds extracts of Northeast Portugal honey. Food and Chemical Toxicology, 46(12), 3774–3779. https://doi. org/10.1016/j.fct.2008.09.062 Eswaran, V. U., & Bhargava, H. R. (2014). Chemical analysis and anti-microbial activity of Karnataka bee bread of Apis species. World Applied Sciences Journal, 32(3), 379–385. https://doi.org/10.5829/idosi.wasj.2014.32.03.1006 Evans, J. D., Schwarz, R. S., Chen, Y.-P., Budge, G., Cornman, R. S., De La Rua, P., De Miranda, J. R., Foret, S., Foster, L., Gauthier, L., Genersch, E., Gisder, S., Jarosch, A., Kucharski, R., Lopez, D., Lun, C. M., Moritz, R. F. A., Maleszka, R., Muñoz, I., & Pinto, M. A. (2013). Standard methodologies for molecular research in Apis mellifera. In V. Dietemann, J. D. Ellis & P. Neumann (Eds), The COLOSS BEEBOOK, Volume I: stand- ard methods for Apis mellifera research. Journal of Apicultural Research, 52(4), https://doi.org/10.3896/IBRA.1.52.4.11 Fabre, N., Rustan, I., Hoffmann, E., & Quetin-Leclercq, J. (2001). Determination of flavone, flavonol and flavanone aglycones by negative ion LC–ES ion trap mass spectrometry. Journal of the American Society for Mass Spectrometry, 12(6), 707–715. https:// doi.org/10.1016/S1044-0305(01)00226-4 Faegri, K., Kaland P, E., & Krzywinski, K. (1993). Bestimmungsschlussel fur die nordwesteuropaische pollenflora (p. 85). G. Fischer. Fanali, C., Dugo, L., & Rocco, A. (2013). Nano-liquid chroma- tography in nutraceutical analysis: determination of polyphe- nols in bee pollen. Journal of Chromatography. A, 1313, 270–274. https://doi.org/10.1016/j.chroma.2013.06.055 FAO/IPGRI. (2001). Multi-crop passport descriptors. http://www. bioversityinternational.org/fileadmin/bioversity/publications/ pdfs/124.pdf Fatrcova-Sramkova, K., Nȏzkova, J., Kacaniova, M., Mariassyova, M., & Kropkova, Z. (2010). Microbial properties, nutritional composition and antioxidant activity of Brassica napus subsp. napus L. bee pollen used in human nutrition. Ecological Chemistry and Engineering A, 17(1), 45–54. Fatrcova-Sramkova, K., No^zkova, J., Kacaniova, M., & Mariassyova, M. (2011). Antioxidant and antimicrobial prop- erties of monofloral bee pollen usable in human nutrition. In Chemicke Listy, 105(Suppl), 1005–1006. https://doi.org/10. 1080/03601234.2013.727664 Fatrcova-Sramkova, K., No^zkova, J., Kacaniova, M., Mariassyova, M., Rovna, K., & Stricık, M. (2013). Antioxidant and antimicrobial properties of monofloral bee pollen. Journal of Environmental Science and Health. Part. B, Pesticides, Food Contaminants, and Agricultural Wastes, 48(2), 133–138. https://doi.org/10.1080/03601234.2013.727664 Feas, X., Vazquez-Tato, M. P., Estevinho, L., Seijas, J. A., & Iglesias, A. (2012). Organic bee pollen: Botanical origin, nutritional value, bioactive compounds, antioxidant activity and microbiological quality. Molecules, 17(7), 8359–8377. http://dx.doi.org/10.3390/molecules17078359 Forcone, A., Aloisi, P. V., Ruppel, S., & Munoz, M. (2011). Botanical composition and protein content of pollen col- lected by Apis mellifera L. in the north-west of Santa Cruz (Argentinean Patagonia). Grana, 50(1), 30–39. https://doi. org/10.1080/00173134.2011.552191 Ferreres, F., Pereira, D. M., Valent~ao, P., & Andrade, P. B. (2010). First report of non-coloured flavonoids in Echium plantagineum bee pollen: Differentiation of isomers by liquid chromatography/ ion trap mass spectrometry. Rapid Communications in Mass Spectrometry, 24(6), 801–806. https://doi.org/10.1002/rcm.4454 100 M. G. Campos et al. Fogle, H. W. (1977). Identification of tree fruit species by pol- len ultrastructure. Journal – American Society for Horticultural Science, 102(5), 548–551. Fontanals, N., Marce, R. M., & Borrull, F. (2007). New materi- als in sorptive extraction techniques for polar compounds. Journal of Chromatography. A, 1152(1-2), 14–31. https://doi. org/10.1016/j.chroma.2006.11.077 Forcone, A., Aloisi, P. V., Ruppel, S., & Munoz, M. (2011). Botanical composition and protein content of pollen col- lected by Apis mellifera L. in the north-west of Santa Cruz (Argentinean Patagonia). Grana, 50(1), 30–39. https://doi. org/10.1080/00173134.2011.552191 Fossel, A.-M., & Pechhacker, H. (2001). Bienen and blumen (p. 676). Institut fur Bienenkunde. Franco, B. D. G. M. (2002). Fatores intrınsecos e extrınsecos que controlam o desenvolvimento microbiano nos alimen- tos. In B. D. G. M. Franco & M. Landgraf (Eds.), Microbiologia dos Alimentos (pp. 13–26). Atheneu. Fukunaga, K., & Hostetler, L. (1975). The estimation of the gradient of a density function, with applications in pattern recognition. IEEE Transactions on Information Theory, 21(1), 32–40. https://doi.org/10.1109/TIT.1975.1055330 Galimberti, A., De Mattia, F., Bruni, I., Scaccabarozzi, D., Sandionigi, A., Barbuto, M., Casiraghi, M., & Labra, M. (2014). A DNA barcoding approach to characterize pollen collected by honeybees. PLoS One, 9(10), e109363. https:// doi.org/10.1371/journal.pone.0109363 Gasic, U., Keckes, S., Dabic, D., Trifkovic, J., Milojkovic- Opsenica, D., Natic, M., & Tesic, Z. (2014b). Phenolic pro- file and antioxidant activity of Serbian polyfloral honeys. Food Chemistry, 145, 599–607. https://doi.org/10.1016/j.food- chem.2013.08.088 Gasic, U., Sikoparija, B., Tosti, T., Trifkovic, J., Milojkovic- Opsenica, D., Natic, M., & Tesic, Z. Z (2014a). Phytochemical fingerprints of lime honey collected in Serbia. Journal of AOAC International, 97(5), 1259–1267. https://doi.org/10.5740/jaoacint.SGEGasic Germano, M. I. S., Germano, P. M. L., Kamei, C. A. K., Abreu, E. S. d., Ribeiro, E. R., Silva, K. C. d., Lamardo, L. C. A., Rocha, M. F. G., Vieira, V. K. I., & Kawasaki, V. M. (2000). Manipuladores de alimentos: capacita? E preciso! Regulamentar? Sera preciso? HigieneAlimentar, 14(78/79), 18–22. Gilber, M. D., & Lisk, D. J. (1978). Honey as an environmental indicator of radionuclide contamination. Bulletin of Environmental Contamination and Toxicology, 19(1), 32–34. https://doi.org/10.1007/BF01685763 Gilliam, M., Prest, D. B., & Lorenz, B. J. (1989). Microbiology of pol- len and bee bread: taxonomy and enzimology of molds. Apidologie, 20(1), 53–68. https://doi.org/10.1051/apido:19890106 Glazer, A. N. (1990). Phycoerythrin fluorescence-based assay for reactive oxygen species . Methods in Enzymology, 186, 161–168. https://doi.org/10.1016/0076-6879(90)86106-6 Glazunov, K. P. (2001 Pollen as an indicator of negative environmental factors: embryological aspect [Paper presentation]. International Seminar: Pollen as an Indicator of Environmental and Paleoecological Reconstruction, pp. 61–63. (Article in Russian). Goh, K., Chang, E., & Cheng, K. (2001). SVM binary classifier ensembles for image classification [Paper presentation]. Proceedings of the ACM Conference Information and Knowledge Management, New York, pp. 395–402. https:// doi.org/10.1145/502585.502652 Goh, K., Chang, E., & Li, B. (2005). Using one-class and two- class SVMs for multiclass image annotation. IEEE Transactions on Knowledge and Data Engineering, 17(10), 1333–1346. https://doi.org/10.1109/TKDE.2005.170 Gok, S., Severcan, M., Goormaghtigh, E., Kandemir, I., & Severcan, F. (2015). Differentiation of Anatolian honey sam- ples from different botanical origins by ATR-FTIR spectroscopy using multivariate analysis. Food Chemistry, 170, 234–240. https://doi.org/10.1016/j.foodchem.2014.08. 040 Gonzalez, R. C., & Woods, R. E. (2008). Digital image process- ing (3rd ed.). Prentice Hall. Graikou, K., Kapeta, S., Aligiannis, N., Sotiroudis, G., Chondrogianni, N., Gonos, E., & Chinou, I. (2011). Chemical analysis of Greek pollen – Antioxidant, antimicro- bial and proteasome activation properties. Chemistry Central Journal, 5(1), 33–39. https://doi.org/10.1186/1752-153X-5-33 Greenham, J., Williams, C., & Harborne, J. B. (1995). Identification of lipophilic flavonols by a combination of chromatographic and spectral techniques. Phytochemical Analysis, 6(4), 211–217. https://doi.org/10.1002/pca.2800060407 Grembecka, M., & Szefer, P. (2013). Evaluation of honeys and bee products quality based on their mineral composition using multivariate techniques. Environmental Monitoring and Assessment, 185(5), 4033–4047. https://doi.org/10.1007/ s10661-012-2847-y Gu, D., Yang, Y., Abdulla, R., & Aisa, H. A. (2012). Characterization and identification of chemical compositions in the extract of Artemisia rupestris L. by liquid chromatog- raphy coupled to quadrupole time-of-flight tandem mass spectrometry. Rapid Communications in Mass Spectrometry, 26(1), 83–100. https://doi.org/10.1002/rcm.5289 Guide for the Care and Use of Laboratory Animals Eighth Edition. (2011). The National Academies Press 500 Fifth Street, NW Washington, DC 20001. www.national-academies.org Guo, J. T., Lee, H. L., Chiang, S. H., Lin, F. I., & Chang, C. Y. (2020). Antioxidant properties of the extracts from different parts of broccoli in Taiwan. Journal of Food and Drug Analysis, 9(2), 96–101. https://doi.org/10.38212/2224-6614.2795 Harborne, J. B., & Boardley, M. (1984). Use of high performance liquid chromatography in the separation of flavonol glycosides and flavonol sulphates. Journal of Chromatography A, 299(2), 377–385. https://doi.org/10.1016/S0021-9673(01)97853-7 Hartmann, T., & Toppel, G. (1987). Senecionine n-oxide. The primary product of pyrrolizidine alkaloid biosynthesis in root cultures of Senecio vulgaris. Phytochemistry, 26(6), 1639–1643. https://doi.org/10.1016/S0031-9422(00)82261-X Hartmann, T., & Witte, L. (1995). Chemistry, biology and che- moecology of the pyrrolizidine alkaloids. In S. W. Pelletier (Ed.), Alkaloids: Chemical and biological perspectives (Vol. 9, pp. 155–233). Pergamon Press. https://doi.org/10.1016/ b978-0-08-042089-9.50011-5 Haussmann, B. I. G., & Parzies, H. K. (2009). Methodologies for generating variability: Part 1: Use of genetic resources in plant breeding. In S. Ceccarelli (Ed.), Plant breeding and farmer participation (pp. 107–128). FAO of the UN. Heo, M. Y., Sohn, S. J., & Au, W. W. (2001). Anti-genotoxicity of galangin as a cancer chemopreventive agent candidate. Mutation Research, 488(2), 135–150. https://doi.org/10.1016/ S1383-5742(01)00054-0 http://www.mercola.com/article/ diet/bee_pollen.htm. Herbert, E. W. J. (1992). Honey bee nutrition. In J. E. Graham (Ed.), The hive and the honey bee (pp. 197–233). Dadant & Sons Inc. Herbert, E. W. J., & Shimanuki, H. (1978). Chemical composition and nutritive value of bee-collected and bee-stored pollen. Apidologie, 9(1), 33–40. https://doi.org/10.1051/apido:19780103 Hewitt, W., & Vincent, S. (1989). Theory and application of microbiological assay. Academic Press. Hleba, L., Pochop, J., Fels€ociova, S., Petrova, J., Cubon, J., Pavelkova, A., & Kacaniova, M. (2013). Antimicrobial effect of bee collected pollen extract to Enterobacteriaceae Genera after application of bee collected pollen in their feeding. Animal Science and Biotechnologies, 46(2), 108–113. Hleba, L., Pochop, J., Fels€ociova, S., Petrova, J., Cubon, J. & Pavelkova, A. (2013). Characterization of chemical Standard methods for pollen research 101 composition of bee pollen in China. Food Chemistry, 61(3), 708–718. https://doi.org/10.1021/jf304056b Hodges, D. (1952). The pollen loads of the honey bee (p. 154). Bee Research Association. Human, H., Brodschneider, R., Dietemann, V., Dively, G., Ellis, J. D., Forsgren, E., Fries, I., Hatjina, F., Hu, F.-L., Jaffé, R., Jensen, A. B., Köhler, A., Magyar, J., Özikrim, A., Pirk, C. W. W., Rose, R., Strauss, U., Tanner, G., Tarpy, D. R., van der Steen, J. J. M., Vaudo, A., Vejsnaes, F., Wilde, J., Williams, G. R., & Zheng, H.-Q. (2013). Miscellaneous standard methods for Apis mellifera research. In V. Dietemann, J. D. Ellis & P. Neumann (Eds), The COLOSS BEEBOOK, Volume I: standard methods for Apis mellifera research. Journal of Apicultural Research, 52(4), https://doi.org/ 10.3896/IBRA.1.52.4.10 Human, H., & Nicolson, S., W. (2006). Nutritional content of fresh, bee-collected and stored pollen of Aloe greatheadii var. davyana (Assphodelaceae). Phytochemistry, 67(14), 1486–1492. https://doi.org/10.1016/j.phytochem.2006.05.023 Ibrahim, A., & Spivak, M. (2006). The relationship between hygienic behavior and suppression of mite reproduction as honey bee (Apis mellifera) mechanisms of resistance to Varroa destructor. Apidologie, 37(1), 31–40. https://doi.org/10. 1051/apido:2005052 Ionita, P. (2005). Is DPPH stable free radical a good scavenger for oxygen active species? Chemical Papers, 50(1), 11–16. Jaiswal, S., Mansa, N., Prasad, M. S., Jena, B. S., & Negi, P. S. (2014). Antibacterial and antimutagenic activities of (Dillenia indica) extracts. Food Bioscience, 5, 47–53. https://doi.org/10. 1016/j.fbio.2013.11.005 Jakobek, L. (2015). Interactions of polyphenols with carbohy- drates, lipids and proteins. Food Chemistry, 175, 556–567. https://doi.org/10.1016/j.foodchem.2014.12.013 Jiang, L. (2011). Comparison of disk diffusion, agar dilution, and broth microdilution for antimicrobial susceptibility testing of five chitosans [Thesis in Master of Science]. Faculty of the Louisiana State University and Agricultural and Mechanical College, Department of Food Science. Jorgensen, J. H., & Ferraro, M. J. (2009). Antimicrobial suscep- tibility testing: A review of general principles and contem- porary practices. Clinical Infectious Diseases, 49(11), 1749–1755. https://doi.org/10.1086/647952 Kacaniova, M., Vukovic, N., Chlebo, R., Hascık, P., Rovna, K., Cubon, J., Dzugan, M., & Pasternakiewicz, A. (2012). The antimicrobial activity of honey, bee pollen loads and bees- wax from Slovakia. Archives of Biological Sciences, 64(3), 927–934. https://doi.org/10.2298/ABS1203927K Kacaniova, M., Terentjeva, M., Petrova, J., Hleba, L., Shevtsova, T., Kluz, M., Rozek, P., & Vukovic, N. (2014). Antimicrobial activity of non-traditional plant pollen against different spe- cies of microorganisms. Journal of Microbiology Biotechnology and Food Science, 4(1), 80–82. http://dx.doi.org/10.15414/ jmbfs.2014.4.1.80-82 Kao, Y. T., Lu, M. J., & Chen, C. (2020). Preliminary analysis of phenolic compounds and antioxidant activities in tea pollen extracts. Journal of Food and Drug Analysis, 19(4), 470–477. https://doi.org/10.38212/2224-6614.2177 Kaur, C., & Kapoor, H. C. (2001). Antioxidants in fruits and vegetables-the millennium’s health. International Journal of Food Science and Technology, 36(7), 703–725. https://doi.org/ 10.1046/j.1365-2621.2001.00513.x Kaur, R., Nagpal, A., & Katnoria, J. K. (2015). Exploration of antitumor properties of pollen grains of plant species belonging to Fabaceae family. Journal of Pharmaceutical Sciences and Research, 7(3), 127–129. Keckes, S., Gasic, U., Velickovic, T. C., Milojkovic-Opsenica, D., Natic, M., & Tesic, Z. (2013). The determination of phenolic profiles of Serbian unifloral honeys using ultra- high-performance liquid chromatography/high resolution accurate mass spectrometry. Food Chemistry, 138(1), 32–40. https://doi.org/10.1016/j.foodchem.2012.10.025 Kedves, M., Kocsicska, I., & Priskin, K. (2003). Transmission electron microscopy of the connectives of the pollen grains of Ginkgo biloba L. Plant Cell Biology and Development, Szeged, 15, 28–42. Kedves, M., Pardutz, A., & Horvath, A. (2002). Transmission electron microscopy of partially degraded pollen grains of Ambrosia artemisiifolia (ragweed). Plant Cell Biology and Development, Szeged, 14, 49–58. Kelina, I., Saavedra, C., Consuelo Rojas, I., Guillermo, E., & Delgado, P. (2013). Pollinic characteristics and chemical composition of bee pollen collected in Cayalti (Lambayeque – Peru). Revista Chilena de Nutricion, 40(1), 71–78. Keller, A., Danner, N., Grimmer, G., Ankenbrand, M., von der Ohe, K., von der Ohe, W., Rost, S., H€artel, S., & Steffan- Dewenter, I. (2015). Evaluating multiplexed next-generation sequencing as a method in palynology for mixed pollen samples. Plant Biology, 17(2), 558–566. https://doi.org/10.1111/plb.12251 Keller, A., Hohlfeld, S., Kolter, A., Schultz, J., Gemeinholzer, B., & Ankenbrand, M. J. (2020). BCdatabaser: On-the-fly reference database creation for (meta-)barcoding. Bioinformatics, 36(8), 2630–2631. https://doi.org/10.1093/bioinformatics/btz960 Keller, I., Fluri, P., & Imdorf, A. (2005). Pollen nutrition and colony development in honey bees: Part I. Bee World, 86(1), 3–10. https://doi.org/10.1080/0005772X.2005.11099641 Kempf, M., Beuerle, T., B€uhringer, M., Denner, M., Trost, D., von der Ohe, K., Bhavanam, V. B. R., & Schreier, P. (2008). Pyrrolizidine alkaloids in honey: Risk analysis by gas chromatog- raphy-mass spectrometry. Molecular Nutrition & Food Research, 52(10), 1193–1200. https://doi.org/10.1002/mnfr.200800051 Kempf, M., Heil, S., Hasslauer, I., Schmidt, L., von der Ohe, K., Theuring, C., Reinhard, A., Schreier, P., & Beuerle, T. (2010). Pyrrolizidine alkaloids in pollen and pollen products. Molecular Nutrition & Food Research, 54(2), 292–300. https:// doi.org/10.1002/mnfr.200900289 Kempf, M., Wittig, M., Reinhard, A., von der Ohe, K., Blacquiere, T., Raezke, K.-P., Michel, R., Schreier, P., & Beuerle, T. (2011). Pyrrolizidine alkaloids in honey: Comparison of analytical methods. Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment, 28(3), 332–347. https://doi.org/10.1080/ 19440049.2010.521772 Khynriam, D., & Prasad, S. B. (2003). Changes in glutathione- related enzymes in tumor-bearing mice after cisplatin treat- ment. Cell Biology and Toxicology, 18(6), 1573–6822. Kirk, W. D. J. (1994). A color guide to pollen loads of the honey bee (p. 54). International Bee Research Association. Klancnik, A., Piskernik, S., Jersek, B., & Mozina, S. S. (2010). Evaluation of diffusion and dilution methods to determine the antibacterial activity of plant extracts. Journal of Microbiological Methods, 81(2), 121–126. https://doi.org/10. 1016/j.mimet.2010.02.004 Klungness, L. M., & Peng, Y.-S. (1983). A scanning electron microscopic study of pollen loads collected and stored by honey bees. Journal of Apicultural Research, 22(4), 264–271. https://doi.org/10.1080/00218839.1983.11100598 Koleva, I. I., VAN Beek, T. A., Linssen, J. P. H., De Groot, A., & Evstatieva, L. N. (2002). Screening of plant extracts for antioxidant activity: A comparative study on three testing methods. Phytochemical Analysis, 13(1), 8–17. https://doi.org/ 10.1002/pca.611 Komosinska-Vassev, K., Olczyk, P., Kafmierczak, J., Mencner, L., & Olczyk, K. (2015) Bee pollen: Chemical composition and therapeutic application. Evidence-Based Complementary and Alternative Medicine, 2015, 1–6. https://doi.org/10.1155/ 2015/297425. K€oppler, K., Vorwohl, G., & Koeniger, N. (2007). Comparison of pollen spectra collected by four different subspecies of 102 M. G. Campos et al. the honey bee Apis mellifera. Apidologie, 38(4), 341–353. https://doi.org/10.1051/apido:2007020 Kostic, A. Z., Barac, M. B., Stanojevic, S. P., Milojkovic-Opsenica, D. M., Tesic, Z. L., Sikoparija, B., Radisic, P., Prentovic, M., & Pesic, M. B. (2015). Physicochemical composition and techno- functional properties of bee pollen collected in Serbia. LWT – Food Science and Technology, 62(1), 301–309. https://doi.org/10. 1016/j.lwt.2015.01.0310023-6438 Kozich, J. J., Westcott, S. L., Baxter, N. T., Highlander, S. K., & Schloss, P. D. (2013). Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and Environmental Microbiology, 79(17), 5112–5120. https://doi.org/10.1128/AEM.01043-13 Kraaijeveld, K., de Weger, L. A., Ventayol Garcıa, M., Buermans, H., Frank, J., Hiemstra, P. S., & den Dunnen, J. T. (2015). Efficient and sensitive identification and quantifica- tion of airborne pollen using next-generation DNA sequencing. Molecular Ecology Resources, 15(1), 8–16. https:// doi.org/10.1111/1755-0998.12288 Kroyer, G., & Hegedus, N. (2001). Evaluation of bioactive prop- erties of pollen extracts as functional dietary food supplement. Innovative Food Science & Emerging Technologies, 2(3), 171–174. https://doi.org/10.1016/S1466-8564(01)00039-X Langford, M., Taylor, G., & Flenley, J. (1990). Computerized identification of pollen grains by texture analysis. Review of Palaeobotany and Palynology, 64(1-4), 197–203. https://doi. org/10.1016/0034-6667(90)90133-4 Lautraite, S., Musonda, A. C., Doehmer, J., Edwards, G. O., & Chipman, J. K. (2002). Flavonoids inhibit genetic toxicity produced by carcinogens in cells expressing CYP1A2 and CYP1A1. Mutagenesis, 17(1), 45–53. https://doi.org/10.1093/ mutage/17.1.45 LeBlanc, B. W., Davis, O. K., Boue, S., DeLucca, A., & Deeby, T. (2009). Antioxidant activity of Sonoran Desert bee pol- len. Food Chemistry, 115(4), 1299–1305. https://doi.org/10. 1016/j.foodchem.2009.01.055 Lee, K.-H., Kim, A.-J., & Choi, E.-M. (2009). Antioxidant and anti- inflammatory activity of pine pollen extract in vitro. Phytotherapy Research, 23(1), 41–48. https://doi.org/10.1002/ptr.2525 Leja, M., Mareczek, A., Wy_zgolik, G., Klepacz-Baniak, J., & Czekonska, K. (2007). Antioxidative properties of bee pol- len in selected plant species. Food Chemistry, 100(1), 237–240. https://doi.org/10.1016/j.foodchem.2005.09.047 Leong, L. P., & Shui, G. (2002). An investigation of antioxidant capacity of fruits in Singapore market. Food Chemistry, 76(1), 69–75. https://doi.org/10.1016/S0308-8146(01)00251-5 Li, A., Zhang, Q., Zhang, G., Chen, J., Fei, Z., & Liu, F. (2002). Adsorption of phenolic compounds from aqueous solutions by a water-compatible hypercrosslinked polymeric adsorb- ent. Chemosphere, 47(9), 981–989. https://doi.org/10.1016/ S0045-6535(01)00222-3 Li, P., & Flenley, J. R. (1999). Pollen texture identification using neural networks. Grana, 38(1), 59–64. In https://doi.org/10. 1080/001731300750044717 Lindtner, P. (2014). Garden plants for honey bees (p. 389). Wicwas Press LLC. Liolios, V., Tananaki, C., Dimou, M., Kanelis, D., Goras, G., Karazafiris, E., Thrasyvoulou, A. (2014). Predict the chemical composition of pollen. In Proceedings of International Symposium on Bee Products, 3rd edition, September 28th –October 1st, p. 28. Lokutova, O. (2014). Quality of bee products in context of envir- onmental safety. Zbornık vedeckych prac a vysledkov z riesenia vyskumneho projektu Podpora inovacie technologiı specialnych vyrobkov biopotravın pre zdravu vyzivu l'udı – Slovenska pol'nohospodarska univerzita v Nitre, pp. 182–188. Loper, G. M., Standifer, L. N., Thompson, M. J., & Gilliam, M. (1980). Biochemistry and microbiology of bee collected almond (Prumus dulcis) pollen and bee bread. I Fatty acids, vitamins and minerals. Apidologie, 11(1), 63–73. https://doi. org/10.1051/apido:19800108 Louveaux, J., Maurizio, A., & Vorwohl, G. (1978). Methods of melissopalynology. Bee World, 59(4), 139–157. https://doi. org/10.1080/0005772X.1978.11097714 Lucchese, L., Mitra, S. (2001). Color image segmentation: A state-of-the-art survey. In Proceedings of the Indian National Science Academy (INSA-A), pp. 207–221. Lv, H., Wang, X., He, Y., Wang, H., & Suo, Y. (2015). Identification and quantification of flavonoid aglycones in rape bee pollen from Qinghai-Tibetan Plateau by HPLC- DAD-APCI/MS. Journal of Food Composition and Analysis, 38, 49–54. https://doi.org/10.1016/j.jfca.2014.10.011 Madejczyk, M., & Baralkiewicz, D. (2008). Characterization of Polish rape and honeydew honey according to their mineral contents using ICP-MS and F-AAS/AES. Analytica Chimica Acta, 617(1-2), 11–17. https://doi.org/10.1016/j.aca.2008.01.038 Makena, P. S., Pierce, S. C., Chung, K. T., & Sinclair, S. E. (2009). Comparative mutagenic effects of structurally simi- lar flavonoids quercetin and taxifolin on tester strains Salmonella typhimurium TA102 and Escherichia coli WP-2 uvrA. Environmental and Molecular Mutagenesis, 50(6), 451–459. https://doi.org/10.1002/em.20487 Margaoan, R., Marghitas, L., Al, Dezmirean, D. S., Bobis, O., & Mihai, C. M. (2012). Physical-Chemical composition of fresh bee pollen from Transylvania. Bulletin UASVM Animal Science and Biotechnologies, 69(1-2), 351–355. Marghitas¸, L. A., Stanciu, O. G., Dezmirean, D. S., Bobis¸, O., Popescu, O., Bogdanov, S., & Campos, M. G. (2009). In vitro antioxidant capacity of honey bee-collected pollen of selected floral origin harvested from Romania. Food Chemistry, 115(3), 878–883. https://doi.org/10.1016/j.food- chem.2009.01.014 Markham, K., & Campos, M. G. (1996). 7- and 8-O-methylher- bacetin-3-O-sophoroside from bee pollens and some struc- ture/activity observations. Phytochemistry, 43(4), 763–767. https://doi.org/10.1016/0031-9422(96)00286-5 Markham, K. R., & Geiger, H. (1993). 1H nuclear magnetic reson- ance spectroscopy of flavonoids and their glycosides in hexadeu- terodimethylsulphoxide. In J. B. Harborne (Ed.), The flavonoids: Advances in research since 1986. Chapman and Hall, pp. 441–496. Markowicz Bastos, D. H., Barth, M. O., Rocha, C. I., Cunha, I. B. S., Carvalho, P. O., Torres, E. A. S., & Michelan, M. (2004). Fatty acid composition and palynological analysis of bee (Apis) pollen loads in the states of S~ao Paulo and Minas Gerais, Brazil. Journal of Apicultural Research, 43(2), 35–39. https://doi.org/10.1080/00218839.2004.11101107 Marsh, J., & Goode, J. A. (Eds.) (1994). Antimicrobial Peptides ICiba Foundation Symposium 186]. John Wiley & Sons. Martins, M. C. T., Morgano, M. A., Vincente, E., Baggio, S. R., & Rodriguez-Amaya, D. B. (2011). Physicochemical compos- ition of bee pollen from eleven Brazilian states. Journal of Apicultural Science, 55(2), 107–116. Maruyama, H., Sakamoto, T., Araki, Y., & Hara, H. (2010). Anti-inflammatory effect of bee pollen ethanol extract from Cistus sp of Spanish on carrageenan-induced rat hind paw edema. BMC Complementary and Alternative Medicine, 10(1), 11. https://doi.org/10.1186/1472-6882-10-30 Matuschek, E., Brown, D. F. J., & Kahlmeter, G. (2014). Development of the EUCAST disk diffusion antimicrobial sus- ceptibility testing method and its implementation in routine microbiology laboratories. Clinical Microbiology and Infection, 20(4), O255–O266. https://doi.org/10.1111/1469-0691.12373 Maurizio, A., & Louveaux, J. (1965). Pollens de plantes melliferes d’Europe (p. 148). Union des Groupements apicoles Franc¸ais. McMurdie, P. J., & Holmes, S. (2013). phyloseq: An R package for reproducible interactive analysis and graphics of micro- biome census data. PLoS One, 8(4), e61217. https://doi.org/ 10.1371/journal.pone.0061217 Standard methods for pollen research 103 Mejıas, E., & Montenegro, G. (2012). The antioxidant activity of Chilean honey and bee pollen produced in the Llaima volcano’s zonez. Journal of Food Quality, 35(5), 315–322. https://doi.org/10.1111/j.1745-4557.2012.00460.x Melo, E. A., Filho, J. M., & Guerra, N. B. (2005) Characterization of antioxidant compounds in aqueous coriander extract (Coriandrum sativum L.). LWT—Food Science and Technology, 38, 15–19. https://doi.org/10.1016/j.lwt.2004.03.011. Melo, I. L. P., & Almeida-Muradian, L. B. (2010). Stability of anti- oxidants vitamins in bee pollen samples. Quımica Nova, 33(3), 514–518. https://doi.org/10.1590/S0100-40422010000300004 Melo, I. L. P., & Almeida-Muradian, L. B. (2011). Comparison of methodologies for dried bee pollen's moisture determin- ation. Ci^encia e Tecnologia de Alimentos, 31(1), 194–197. v. https://doi.org/10.1590/S0101-20612011000100029 Melo, I. L. P., Freitas, A. S., Barth, O. M., & Almeida-Muradian, L. B. (2009). Relac¸~ao entre a composic¸~ao nutricional e a origem floral de polen apıcola desidratado. [Correlation between nutritional composition and floral origin of dried bee pollen]. Revista Do Instituto Adolfo Lutz, 68, 346–353. Melo, A. A. M., Meira, D. F. S., Chan, J., Sattler, J. A. G., & Almeida-Muradian, L. B. (2012a). Comparac¸~ao entre metodos de extrac¸~ao de compostos antioxidantes do polen apıcola desidratado. In: 11 Encontro de Quımica de Alimentos, Braganc¸a. 11 Encontro de Quımica de Alimentos – Qualidade dos alimentos: novos desafios/Resumos, p. 65–65. Melo, A. A. M., Meira, D. F. S., Sattler, J. A. G., & Almeida- Muradian, L. B. (2012b). Atividade antioxidante do polen apıcola desidratado avaliada por diferentes metodos de extrac¸~ao. Mensagem Doce (Associac¸~ao Paulista de Apicultores, Criadores de Abelhas Melificas Europeias), S~ao Paulo, p. 59, 22 maio. Melo, A. A. M., Meira, D. F. S., Sattler, J. A. G., & Almeida- Muradian, L. B. (2012c). Antioxidant activity of bee pollen produced in two Brazilian states [Paper presentation]. 5th European Conference of Apidology, Halle an Der Saale. EurBee 5 – 5th European Conference of Apidology (p. 223). Melo, A. A. M., Meira, D. F. S., Sattler, J. A. G., Almeida- Muradian, L. B. (2012d). Antioxidant activity of dehydrated bee pollen produced in Rio Grande do Sul state, Brazil. In II International Symposium on Bee Products/Annual Meeting of IHC, Braganc¸a/Book of Abstracts (p. 75). Melo, A. A. M., Nagai, M. K., Chan, J., & Almeida-Muradian, L. B. (2013). Chemical composition, total phenolic com- pounds and antioxidant activity of dehydrated bee pollen produced in four Brazilian states. In XXXXIII International Apicultural Congress. Apimondia – Scientific Program/Posters. Menezes, J. D. S., Maciel, L. F., Miranda, M. S., & Druzian, J. I. (2010). Compostos bioactivos e potencial antioxidante de polen apıcola producido por abelhas africanizadas (Apis mel- lifera L.). Revista do Instituto Adolfo Lutz, 69(2), 233–242. Molyneux, P. (2004). The use of the stable free radical diphenyl- picryl-hydracyl (DPPH) for estimating antioxidant activity. Songklanakarin Journal of Science and Technology, 26, 211–219. Montenegro, G., Pizarro, R., Mejıas, E., & Rodrıguez, S. (2013). Evaluacion biologica de polen apıcola de plantas de Chile. Revista Internacional de Botanica Experimental, 82, 7–14. Morais, M., Moreira, L., Feas, X., & Estevinho, L. M. (2011). Honeybee-collected pollen from five Portuguese Natural Parks: Palynological origin, phenolic content, antioxidant properties and antimicrobial activity. Food and Chemical Toxicology, 49(5), 1096–1101. https://doi.org/10.1016/j.fct.2011.01.020 Moreira, L., Dias, L. G., Pereira, J. A., & Estevinho, L. (2008). Antioxidant properties, total phenols and pollen analysis of propolis samples from Portugal. Food and Chemical Toxicology, 46(11), 3482–3485. https://doi.org/10.1016/j.fct.2008.08.025 Moreti, A. C. C. C., Marchini, L. C., Souza, V. C., & Rodrigues, R. R. (2002). Atlas do polen de plantas apıcolas. Papel Virtual. Moya, M., Koch, M., Hostetler, L. (1993). One-class classifier networks for target recognition applications. In Proceedings on World Congress on Neural Networks, International Neural Network Society (pp. 797–801). Mullins, J., & Emberlin, J. (1997). Sampling pollens. Journal of Aerosol Science, 28(3), 365–370. https://doi.org/10.1016/ S0021-8502(96)00439-9 Mußmann, P., Levsen, K., & Radeck, W. (1994). Gas-chromato- graphic determination of phenols in aqueous samples after solid phase extraction. Fresenius' Journal of Analytical Chemistry, 348(10), 654–659. https://doi.org/10.1007/BF00325568 Muszynska, J., & Warakomska, Z. (1999). Honey bees in the monitoring of the environment’s contamination: I. The numerousness of the monitoring apiary giving samples of pollen loads, which are representative for a neighborhood rich in pollen flow. Pszczelnicze scientific notebooks – 1999. – Rok XLIII, pp. 197–208. Nagai, T., Inoue, R., Inoue, H., & Suzuki, N. (2002). Scavenging capacities of pollen extracts from Cistus ladanifeus on aut- oxidation, superoxide radicals, hydroxyl radicals, and DPPH radicals. Nutrition Research, 22(4), 519–526. https://doi.org/ 10.1016/S0271-5317(01)00400-6 Nagai, T., Nagashima, T., Suzuki, N., & Inoue, R. (2005). Antioxidant activity and angiotensin I-converting enzyme inhibition by enzymatic hydrolysates from bee bread. Zeitschrift fur Naturforschung. C, Journal of Biosciences, 60(1- 2), 133–138. https://doi.org/10.1515/znc-2005-1-224 Nagy, M., Krizkova, L., Mucaji, P., Kontsekova, Z., Sersen, F., & Krajcovic, J. (2009). Antimutagenic activity and radical scavenging activity of water infusions and phenolics from ligustrum plants leaves. Molecules, 14(1), 509–518. https:// doi.org/10.3390/molecules14010509 Natic, M. M., Dabic, D., C; Papetti, A., Fotiric Aksic, M. M., Ognjanov, V., Ljubojevic, M., & Tesic, Z L. J. (2015). Analysis and characterisation of phytochemicals in mulberry (Morus alba L.) fruits grown in Vojvodina, North Serbia. Food Chemistry, 171, 128–136. https://doi.org/10.1016/j.foodchem.2014.08.101 Negri, G., Teixeira, E., Alves, M. L. T. F., Moreti, A. C. C. C., Otsuk, I. P., Borguini, R. G., & Salatino, A. (2011). Hydroxycinnamic acid amide derivatives, phenolic compounds and antioxidant activities of extracts of pollen samples from Southeast Brazil. Journal of Agricultural and Food Chemistry, 59(10), 5516–5522. https://doi.org/10.1021/jf200602k Niki, E., & Noguchi, N. (2000). Evaluation of antioxidant cap- acity. What capacity is being measured by which method? IUBMB Life, 50(4-5), 323–329. https://doi.org/10.1080/ 15216540051081119 Nogueira, C., Iglesias, A., Feas, X., & Estevinho, L. M. (2012). Commercial bee pollen with different geographical origins: A com- prehensive approach. International Journal of Molecular Sciences, 13(9), 11173–11187. https://doi.org/10.3390/ijms130911173 No^zkova, J., Brindza, J., Ostrovsky, R., Stehlıkova, B., & Fatrcova-Sramkova, K. (2010). Hodnotenie kvantitatıvnych a kvalitatıvnych znakov vcelieho pel'u a ich klasifikacia podl'a navrhnutych deskriptorov: Evaluation of quantitative and qualitative traits of bee pollen and their classification according to proposed list of descriptors. In Potravinarstvo. Zdruzenie HACCP Consulting 2007: Nitrianske Hrnciarovce, Slovensko. 4, 204–216. No^zkova, J., Ostrovsky, R., Brindza, J., & Molnarova, E. (2010). Morfologicka charakteristika vcelıch pel'ovych obno^zok. In B. Brovarskyi (Ed.), Vcelı obno^zkovy pel'. SPU v Nitre (pp. 101–113). No^zkova, J., Pavelek, M., Bjelkova, M., Brutch, N., Tejklova, E., Porokhovinova, E., & Brindza, J. (2011). Descriptor List for Flax – Linum usitatissimum L., Nitra (p. 104). Oh, S. M., & Chung, K. H. (2006). Antiestrogenic activities of Ginkgo biloba extracts. The Journal of Steroid Biochemistry 104 M. G. Campos et al. and Molecular Biology, 100(4-5), 167–176. https://doi.org/10. 1016/j.jsbmb.2006.04.007 Ohta, S., Fujimaki, T., Uy, M. M., Yanai, M., Yukiyoshi, A., & Hirata, T. (2007). Antioxidant hydroxycinnamic acid derivatives iso- lated from Brazilian bee pollen. Natural Product Research, 21(8), 726–732. https://doi.org/10.1080/14786410601000047 Oliveira, K. C. L. S., Moriya, M., Azedo, R. A. B., Almeida- Muradian, L. B., Teixeira, E. W., Alves, M. L. T. M. F., & Moreti, A. C. C. C. (2009). Relationship between botanical origin and antioxidants vitamins of bee-collected pollen. Quımica Nova, 32(5), 1099–1102. https://doi.org/10.1590/ S0100-40422009000500003 Orsolic, N., Kosalec, I., & Basic, I. (2005). Synergistic antitu- mor effect of polyphenolic components of water soluble derivative of propolis against Ehrlich ascites tumour. Biological & Pharmaceutical Bulletin, 28(4), 694–700. https:// doi.org/10.1248/bpb.28.694 Ostrosky, E. A., Mizumoto, M. K., Lima, M. E. L., Kaneko, T. M., Nishikawa, S. O., & Freitas, B. R. (2008). Metodos para avaliac¸~ao da actividade antimicrobiana e determinac¸~ao da concentrac¸~ao mınima inibitoria (CMI) de plantas medici- nais. Revista Brasileira de Farmacognosia, 18(2), 301–307. https://doi.org/10.1590/S0102-695X2008000200026 Otero, M. P., & Losada, S. B. (2002). Metodo de determi- nacion del origen geografico del polen apıcola comercial. Lazaroa, 23, 25–34. Otsu, N. (1979). A threshold selection method from grey- level histograms. IEEE Transactions on Systems, Man, and Cybernetics, 9(1), 62–66. https://doi.org/10.1109/TSMC.1979. 4310076 Ou, B., Hampsch-Woodill, M., & Prior, R. R. (2001). Development and validation of an improved oxygen radical absorbance capacity assay using fluorescein as the fluores- cent probe. Journal of Agricultural and Food Chemistry, 49(10), 4619–4626. https://doi.org/10.1021/jf010586o Ozcan, M., Ceylan, D. A., Unver, A., & Yetisir, R. (2003). Antifungal effect of pollen and propolis extracts collected from different regions of Turkey, Uludag. Bee Journal, 3, 27–34. Ozdal, T., Capanoglu, E., & Altay, F. (2013) A review on pro- tein-phenolic interactions and associated changes. Food Research International, 51, 954–970. https://doi.org/10.1016/j. foodres.2013.02.009. Pabla, N., Huang, S., Mi, Q.-S., Daniel, R., & Dong, Z. (2008). ATR-Chk2 Signaling in p53 Activation and DNA Damage Response during Cisplatin-induced Apoptosis. The Journal of Biological Chemistry, 283(10), 6572–6583. https://doi.org/10. 1074/jbc.M707568200 Panetta, J. C. (1998). O carater educativo da Vigil^ancia Sanitaria. Higiene Alimentar, 12(57), 8–10. Pantelic, M., Dabic, D., Matijasevic, S., Davidovic, S., Dojcinovic, B., Milojkovic-Opsenica, D., Tesic, Z., & Natic, M. (2014). Chemical characterization of fruit wine made from Oblacinska sour cherry. The Scientific World Journal, 2014, 454797–454799. https://doi.org/10.1155/2014/454797 Partap, U. (1997). Bee flora of the Hindu Kush-Himalayas: Inventory and management (p. 297). International Centre for Integrated Mountain Development. Pascoal, A., Rodrigues, S., Teixeira, A., Feas, X., & Estevinho, L. M. (2014). Biological activities of commercial bee pollens: Antimicrobial, antimutagenic, antioxidant and anti-inflamma- tory. Food and Chemical Toxicology, 63, 233–239. https://doi. org/10.1016/j.fct.2013.11.010 Paulino, N., Abreu, S. R., Uto, Y., Koyama, D., Nagasawa, H., Hori, H., Dirsch, V. M., Vollmar, A. M., Scremin, A., Bretz, W. A. (2008). Anti-inflammatory effects of a bioavailable compound, Artepillin C, in Brazilian propolis. European Journal of Pharmacology, 10;587(1–3), 296–301. doi: 10.1016/ j.ejphar.2008.02.067. Epub 2008 Feb 29. PMID: 18474366. Paulo, L., Antunes, P., Campos, M. G., & Anjos, O. (2012). Utilizac¸~ao do Teor em Metais Pesados no Polen Como Marcador Ambiental – Estudo Preliminar. II Congresso Iberico de Apicultura, 18-20 Setembro, Guadalajara, pp. 75–76. Paulo, L., Antunes, P., & Anjos, O. (2014). Mineral compos- ition of pollen using inductively coupled plasma atomic emission spectroscopy. Planta Medica, 80(16), 2–16. https:// doi.org/10.1055/s-0034-1394851 Petersen, J., Souza, E. M. P., Moreira, R. M., Pasin, L. E. V., Nordi, J. C., & Barreto, L. M. R. C. (2011). Comercializac¸~ao do polen apıcola em 11 paıses da America Latina. Magistra, Cruz das Almas-BA, 23(numero especial), 14–16. Pichichero, E., Cicconi, R., Mattei, M., & Canini, A. (2011). Chrysin-induced apoptosis is mediated through p38 and Bax activation in B16-F1 and A375 melanoma cells. International Journal of Oncology, 38(2), 473–483. https://doi. org/10.3892/ijo.2010.876 Pinto, B., Bertoli, A., Noccioli, C., Garritano, S., Reali, D., & Pistelli, L. (2008). Estradiol-antagonistic activity of phenolic compounds from leguminous plants. Phytotherapy Research, 22(3), 362–366. https://doi.org/10.1016/j.fct.2013.11.010. Pinto, B., Caciagli, F., Riccio, E., Reali, D., Saric, A., Balog, T., Likic, S., & Scarpato, R. (2010). Antiestrogenic and antige- notoxic activity of bee pollen from Cystus incanus and Salix alba as evaluated by the yeast estrogen screen and the micronucleus assay in human lymphocytes. European Journal of Medicinal Chemistry, 45(9), 4122–4128. https://doi.org/10. 1016/j.ejmech.2010.06.001 Plumb, R., Castro-Perez, J., Granger, J., Beattie, I., Joncour, K., & Wright, A. (2004). Ultra-performance liquid chromatog- raphy coupled to quadrupole-orthogonal time-of-flight mass spectrometry. Rapid Communications in Mass Spectrometry, 18(19), 2331–2337. https://doi.org/10.1002/rcm.1627 Prakash, A. S., Pereira, T. N., Reilly, P. E. B., & Seawright, A. A. (1999). Pyrrolizidine alkaloids in human diet. Mutation Research/ Genetic Toxicology and Environmental Mutagenesis, 443(1-2), 53–76. https://doi.org/10.1016/S1383-5742(99)00010-1 Prior, R. L., Wu, X., & Schaich, K. (2005). Standardized meth- ods for the determination of antioxidant capacity and phe- nolics in foods and dietary supplements. Journal of Agricultural and Food Chemistry, 53(10), 4290–4302. https:// doi.org/10.1021/jf0502698 Prokudina, E. A., Havlıcek, L., Al-Maharik, N., Lapcık, O., Strnad, M., & Gruz, J. (2012). Rapid UPLC–ESI–MS/MS method for the analysis of isoflavonoids and other phenyl- propanoids. Journal of Food Composition and Analysis, 26(1-2), 36–42. https://doi.org/10.1016/j.jfca.2011.12.001 Qian, W. L., Khan, Z., Watson, D. G., & Fearnley, J. (2008). Analysis of sugars in bee pollen and propolis by ligand exchange chroma- tography in combination with pulse amperometric detection and mass spectrometry. Journal of Food Composition and Analysis, 21(1), 78–83. https://doi.org/10.1016/j.jfca.2007.07.001 Rabie, A. L., Wells, J. D., & Dent, L. K. (1983). The nitrogen con- tent of pollen protein. Journal of Apicultural Research, 22(2), 119–123. https://doi.org/10.1080/00218839.1983.11100572 Rauha, J. P., Vuorela, H., & Kostiainen, R. (2001). Effect of eluent on the ionization efficiency of flavonoids by ion spray, atmospheric pressure chemical ionization, and atmospheric pressure photo- ionization mass spectrometry. Journal of Mass Spectrometry, 36(12), 1269–1280. https://doi.org/10.1002/jms.231 R Core Team. (2014). R: A language and environment for statis- tical computing. R Foundation for Statistical Computing. http://www.R-project.org/ Reiter, R. (1947). The coloration of anther and corbicular pol- len. The Ohio Journal of Science, 17(4), 137–152. http://hdl. handle.net/1811/3589 Rex, J. H., Pfaller, M. A., Walsh, T. J., Chaturvedi, V., Espinel- Ingroff, A., Ghannoum, M. A., Gosey, L. L., Odds, F. C., Rinaldi, M. G., Sheehan, D. J., & Warnock, D. W. (2001). Standard methods for pollen research 105 Antifungal susceptibility testing: Practical aspects and cur- rent challenges. Clinical Microbiology Reviews, 14(4), 643–658. https://doi.org/10.1128/CMR.14.4.643-658.2001 Royal Horticultural Society (RHS). 1966, 1986, 1995, 2004. RHS Color Chart. Royal Horticultural Society. Ricciardelli, D. G. (1982). Analisi organolettico-microscopica dei prodotti apistici: un problema attuale e indilazionabile. L'Ape Nosta Amica, 4, 19–21. Richardson, R. T., Lin, C.-H., Sponsler, D. B., Quijia, J. O., Goodell, K., & Johnson, R. M. (2015). Application of ITS2 meta- barcoding to determine the provenance of pollen collected by honey bees in an agroecosystem. Applications in Plant Sciences, 3(1), 1400066. https://doi.org/10.3732/apps.1400066 Robards, K., & Antolovich, M. (1997). Analytical chemistry of fruit bioflavonoids. The Analyst, 122(2), 11R–34R. https://doi. org/10.1039/a606499j Rochat, B. (2012). Quantitative/qualitative analysis using LC- HRMS: the fundamental step forward for clinical laborato- ries and clinical practice. Bioanalysis, 4(14), 1709–1711. https://doi.org/10.4155/bio.12.159 Rodlauer, R., & H€uttinger, E. (1992). A Computer-supported method of honey pollen analysis. Abstracts of the 8th International palynological Congress, France. p. 40. Rodrıguez, I., Llompart, M. P., & Cela, R. (2000). Solid-phase extraction of phenols. Journal of Chromatography. A, 885(1- 2), 291–304. https://doi.org/10.1016/S0021-9673(00)00116-3 Rodrıguez-Damian, M., Cernadas, E., Formella, A., Fernandez- Delgado, M., & Sa-Otero, P. D. (2006). Automatic detection and classification of grains of pollen based on shape and texture. IEEE Transactions on Systems, Man, and Cybernetics, Part C: Applications and Reviews, 36, 531–542. https://doi.org/ 10.1109/TSMCC.2005.855426 Rodrıguez-Damian, M., Cernadas, E., Formella, A., Sa-Otero, P. (2004). Pollen classification using brightness-based and shape-based descriptors. IEEE Transactions on System, Man, and Cybernetics. Rodrıguez-Damian, M., Formella, A., & Sa-Otero DE, P. (2004 Pollen classification using brightness-based and shape-based descrip- tors [Paper presentation]. Proceedings of the 17th International Conference on Pattern Recognition, ICPR 2004, Vol. 2, pp. 212–215. https://doi.org/10.1109/ICPR.2004.1334098 Rodrıguez-Delgado, M. A., Malovana, S., Perez, J. P., Borges, T., & Garcıa-Montelongo, F. J. (2001). Separation of phen- olic compounds by high-performance liquid chromatography with absorbance and fluorimetric detection. Journal of Chromatography. A, 912(2), 249–257. https://doi.org/10.1016/ S0021-9673(01)00598-2 R€osemann, G. M., Botha, C. J., & Eloff, J. N. (2014). Distinguishing between toxic and non-toxic pyrrolizidine alkaloids and quantification by liquid chromatography–mass spectrometry. Phytochemistry Letters, 8, 126–131. https://doi. org/10.1016/j.phytol.2014.03.002 Rosenthal, C., Petrescu, A., & Caragiani, S. (1969). Cercetari ascupra compozitiei biochimice si valorii biologice a unui produs inlocuitor de pollen. Apicultura, 22(8), 18–21. Rouessac, F., & Rouessac, A. (2007). Sample preparation: Solid phase extraction (SPE). In Francis, A. Rouessac, & S. Brooks (Trans.), Chemical analysis – Modern instrumentation methods and techniques (2nd ed., chapter 21 pp. 487–490). JohnWiley & Sons, Ltd. Rzepecka-Stojko, A., Pilawa, B., Ramos, P., & Stojko, J. (2012). Antioxidative properties of bee pollen extracts examined by EPR spectroscopy. Journal of Apicultural Science, 56(1), 23–30. https://doi.org/10.2478/v10289-012-0003-0 Rzepecka-Stojko, A., Stec, M., Kurzeja, E., Gawronska, E., Pawlowska-Goral, K. (2012). The effect of storage of bee pollen extracts on polyphenol content. Polish Journal of Environmental Studies, 21(4), 1007–1011. http://www.pjoes. com/pdf/21.4/Pol.J.Environ.Stud.Vol.21.No.4.1007-1011.pdf Sahin, H., Aliyazicioglu, R., Yildiz, O., Kolayli, S., Innocenti, A., & Supuran, C. T. (2011). Honey, pollen, and propolis extracts show potent inhibitory activity against the zinc metalloenzyme carbonic anhydrase. Journal of Enzyme Inhibition and Medicinal Chemistry, 26(3), 440–444. https:// doi.org/10.3109/14756366.2010.503610 Salamanca, G., Moreno, C., Quiralte, J., Barber, D., Villalba, M., & Rodriguez, R. (2008). Immunological characterisation of Ole e 11, a major olive pollen allergen. Allergy, 63, 500. Sanchez, E. T. (2004). Polen: Produccion Envasado y Comercializacion. Sanchez-Moreno, C. (2002). Methods used to evaluate the free radical scavenging activity in foods and biological systems. Food Science and Technology International, 8(3), 121–137. Sanchez-Moreno, C., Larrauri, J. A., & Saura-Calixto, F. (1998). A procedure to measure the antiradical efficiency of polyphenols. Journal of the Science of Food and Agriculture, 76(2), 270–276. https://doi.org/10.1002/(SICI)1097-0010(199802)76:2< 270::AID- JSFA945> 3.0.CO;2-9 Santana, C. M., Ferrera, Z. S., Torres Padron, M. E., & Santana Rodrıguez, J. J. (2009). Methodologies for the extraction of phenolic compounds from environmental samples: New approaches. Molecules, 14(1), 298–320. https://doi.org/10.3390/ molecules14010298 Sattler, J. A. G. (2013). Quantificatio of antioxidant vitamins E (alpha-, beta-, gama- and delta-tocopherol), C (ascorbic acid), provitamin A (alpha- and beta-carotene) and chemical compos- ition of dehydrated bee pollen produced in georeferenced apia- ries of southern Brazil [Master dissertation]. University of S~ao Paulo. Retrieved July 7, 2014, from http://www.teses. usp.br/teses/disponiveis/9/9131/tde-18032014-151137/ Sawyer, R. (1981). Pollen identification for beekeepers (p. 112). University College Cardiff Press. Sawyer, R. (1988). Honey identification (p. 115). Cardiff Academic Press. Schieber, A., Keller, P., Streker, P., Klaiber, I., & Carle, R. (2002). Detection of isorhamnetin glycosides in extracts of apples (Malus domestica cv. "Brettacher") by HPLC-PDA and HPLC-APCI-MS/MS. Phytochemical Analysis, 13(2), 87–94. https://doi.org/10.1002/pca.630 Scorzoni, L., Benaducci, T., Almeida, A. M. F., Silva, D. H. S., Bolzani, V. S., & Gianinni, M. J. (2007). The use of standard methodology for determination of antifungal activity of natural products against medical yeasts Candida sp. and Cryptococcus sp. Brazilian Journal of Microbiology, 38, 391–397. https://doi.org/ 10.1590/S1517-83822007000300001. Serra-Bonvehı, J., & Escola Jorda, R. (1997). Nutrient compos- ition and microbiological quality of honey bee-collected pol- len in Spain. Journal of Agricultural and Food Chemistry, 45(3), 725–732. https://doi.org/10.1021/jf960265q Serra-Bonvehı, J., Gonello Galindo, J., & Gomez Pajuelo, A. (1986). Estudio de la composition y caracteristicas fisico- quimicas del pollen de abejas. Alimentaria, 23(176), 63–67. Serra-Bonvehı, J., Torrento, S. M., & Lorente, C. E. (2001). Evaluation of polyphenolic and flavonoid compounds in honey bee – Collected pollen produced in Spain. Journal of Agricultural and Food Chemistry, 49(4), 1848–1853. https://doi.org/10.1021/jf0012300 Sharma, M. (1970). An analysis of pollen loads of honey bees from Kangra, India. Grana, 10(1), 35–42. https://doi.org/10. 1080/00173137009429855 Sharma, O. P., & Bhat, T. K. (2009). DPPH antioxidant assay revisited. Food Chemistry, 113(4), 1202–1205. https://doi.org/ 10.1016/j.foodchem.2008.08.008 Shaw, D. E. (1990). The incidental collection of fungal spores by bees and the collection of spores in lieu of pollen. Bee World, 71(4), 158–176. https://doi.org/10.1080/0005772X.1990.11099059 Shi, H. B., Kong, M., Chen, G., Zhao, J., Shi, H. L., Chen, Y., & Rowan, F. G. (2010). Compound pollen protein nutrient increases serum albumin in cirrhotic rats. Gastroenterology Research, 3(6), 253–261. https://doi.org/10.4021/gr240e 106 M. G. Campos et al. Shoskes, D. A. (2002). Phytotherapy in chronic prostatitis. Urology, 60(6 Suppl), 35–37. https://doi.org/10.1016/S0090- 4295(02)02383-X Sickel, W., Ankenbrand, M. J., Grimmer, G., Holzschuh, A., H€artel, S., Lanzen, J., Steffan-Dewenter, I., & Keller, A. (2015). Increased efficiency in identifying mixed pollen sam- ples by meta-barcoding with a dual-indexing approach. BMC Ecology, 15, 20. https://doi.org/10.1186/s12898-015-0051-y Siddik, Z. (2003). Cisplatin: mode of cytotoxic action and molecular basis of resistance. Oncogene, 22(47), 7265–7279. https://doi.org/10.1038/sj.onc.1206933 Silici, S., & Kutluca, S. (2005). Chemical composition and antibac- terial activity of propolis collected by three different races of honeybees in the same region. Journal of Ethnopharmacology, 99(1), 69–73. https://doi.org/10.1016/j.jep.2005.01.046 Silva, E. N. (1999). Tecnologia de alimentos. Higiene na industria de alimentos. Unicamp- Campinas. 5. Silva, J. A. (2000). Topicos da tecnologia de alimentos. S~ao Paulo: Livraria Varela, 229. 82 pp. Silva, T. M. S., Camara, C. A., da Silva Lins, A. C., Maria Barbosa- Filho, J., da Silva, E. M. S., Freitas, B. M., & de Assis Ribeiro dos Santos, F. (2006). Chemical composition and free radical scav- enging activity of pollen loads from stingless beeMelipona subni- tuda Ducke. Journal of Food Composition and Analysis, 19(6-7), 507–511. https://doi.org/10.1016/j.jfca.2005.12.011 Silva, T. M. S., Camara, C. A., Lins, A. C. S., Agra, M. F., Silva, E. M. S., Reis, I. T., & Freitas, B. M. (2009). Chemical com- position, botanical evaluation and screening of radical scav- enging activity of collected pollen by the stingless bees Melipona rufiventris (Uruc¸u-amarela)). Anais da Academia Brasileira de Ciencias, 81(2), 173–178. https://doi.org/10. 1590/s0001-37652009000200003 Silva, C. I., Bordon, N. G., da, R., Filho, L. C., & Garofalo, C. A. (2012). The importance of plant diversity in maintain- ing the pollinator bee, Eulaema nigrita (Hymenoptera: Apidae) in sweet passion fruit fields. Revista de Biologia Tropical, 60(4), 1553–1565. Smirnova, V. A., Timofeyev, N. K., Breygina, M. A., Matveyeva, N. P., & Yermakov, P. I. (2012). Antioxidant properties of the pollen exine polymer matrix. Biophysics, 57(2), 174–178. https://doi.org/10.1134/S0006350912020224 Snyder, R. D., & Gillies, P. J. (2002). Evaluation of the clasto- genic, DNA intercalative, and topoisomerase II-interactive properties of bioflavonoids in Chinese hamster V79 cells. Environmental and Molecular Mutagenesis, 40(4), 266–276. https://doi.org/10.1002/em.10121 Solberg, Y., & Remedios, G. (1980). Chemical composition of pure and bee-collected pollen. Scientific Reports Agricultural University, Norway, 59(18), 1–13. Somerville, D. C. (2001). Nutritional value of bee collected pollens, a report for the Rural Industries Research and Development Corporation # 01/047 (pp. 57–58). NSW Agriculture Goulburn. Somerville, D. C., & Nicol, H. I. (2002). Mineral content of honey bee collected pollen from southern New South Wales. Australian Journal of Experimental Agriculture, 42(8), 1131–11136. https://doi.org/10.1071/EA01086 Soto-Vaca, A., Gutierrez, A., Losso, J. N., Xu, Z., & Finley, J. W. (2012). Evolution of phenolic compounds from color and flavor problems to health benefits. Journal of Agricultural and Food Chemistry, 60(27), 6658–6677. https://doi.org/10.1021/jf300861c Souza, B. R. (2014). Quantification of B complex vitamins (B1, B2) and vitamers of vitamin B3 and B6 in dehydrated bee pol- len samples from Southern Brazil [Master dissertation]. University of S~ao Paulo. Souza, E. H., Souza, F. V. D., Rossi, M. L., Packer, R. M., Cruz-Barros, M. A. V., & Martinelli, A. P. (2018) Pollen morphology and viability in Bromeliaceae. Annals of the Brazilian Academy of Sciences, 89(4), 3067–3082. http://dx.doi.org/10.1590/0001-3765201720170450. Sparkman, O. D. (2000). Mass spectrometry desk reference. Global View Pub. http://www.amazon.com/exec/obidos/ ASIN/0966081323/102-8754827-3860108 Stalikas, C. D. (2007). Extraction, separation, and detection methods for phenolic acids and flavonoids. Journal of Separation Science, 30(18), 3268–3295. https://doi.org/10. 1002/jssc.200700261 Stanciu, O. G., Marghitas, L. A., Dezmirean, D., & Campos, M. G. (2011). A comparison between the mineral content of flower and honey bee collected pollen of selected plant origin (Helianthus annuus L. and Salix sp.). Romanian Biotechnological Letters, 16(4), 6291–6296. Stanciu, O. G., Marghitas, L. A., & Dezmirean, D. (2012). Nutritional and biological values of bee pollen and beebread harvested from Romania. In Proceedings of International Conference of Agricultural Engineering CIGR-AGENG. http:// journals.usamvcluj.ro/index.php/zootehnie/article/viewFile/ 9391/7820 Stanciu, O. G., Marghitas, L. A., Dezmirean, D., & Campos, M. G. (2012). Specific distribution of minerals in selected unifloral bee pollen. Food Science and Technology Letters, 3(1), 27–31. Stanley, R. G., & Linskens, H. F. (1974). Pollen – Biology, bio- chemistry, management (p. 307). Springer-Verlag. https://doi. org/10.1007/978-3-642-65905-8 Szcze^sna, T. (2006a). Long – Chain fatty acids composition of honey bee-collected pollen. Journal of Apicultural Science, 50, 65–78. Szcze^sna, T. (2006b). Protein content and amino acid compos- ition of bee-collected pollen from selected botanical origins. Journal of Apicultural Science, 50, 81–90. Szcze^sna, T. (2006c). Protein content and amino acids compos- ition of bee-collected pollen originating from Poland, South Korea and China. Journal of Apicultural Science, 50, 91–99. SzczeRsna, T. (2007). Study on the sugar composition of honey- bee-collected pollen. Journal of Apicultural Science, 51(1), 15–21. SzczeRsna, T., & Rybak-Chmielewska, H. (1998). Some properties of honey bee collected pollen. In Polnisch-Deutsches Symposium Salus Apis Mellifera, new demands for honey bee breeding in the 21st century. Pszczelnicze Zeszyty Naukowe, 42(2), 79–80. SzczeRsna, T., Rybak-Chmielewska, H., & Chmielewski, W. (2002). Sugar composition of pollen loads harvested at dif- ferent periods of the beekeeping season. Journal of Apicultural Science, 46(2), 107–115. SzczeRsna, T., Rybak-Chmielewska, H., & Skowronek, W. (1995a). Wpływ utrwalania na wartosc biologiczna˛ obno_zy pyłkowych. Pszczelnicze Zeszyty Naukowe, 39(1), 177–187. SzczeRsna, T., Rybak-Chmielewska, H., & Skowronek, W. (1995b). Zmiany w składzie chemicznym obno_zy pyłkowych zachodza˛ce podczas ich przechowywania w ro_znych warunkach. I. Cukry, tłuszcze, popioł. Pszczelnicze Zeszyty Naukowe, 39(2), 145–156. Taha, E. A. (2015). Chemical composition and amounts of mineral elements in honey bee-collected pollen in relation to botanical origin. Journal of Apicultural Science, 59(1), 75–81. https://doi.org/10.1515/JAS-2015-0008 Tax, D. (2011). DDtools, the data description toolbox for Matlab. Version 1.9.0. Thakur, M., & Nanda, V. (2020). Composition and functionality of bee pollen: A review. Trends in Food Science & Technology, 98, 82–106. https://doi.org/10.1016/j.tifs.2020.02.001 Tian, S., Nakamura, K., Cui, T., & Kayahara, H. (2005). High-per- formance liquid chromatographic determination of phenolic compounds in rice. Journal of Chromatography. A, 1063(1-2), 121–128. https://doi.org/10.1016/j.chroma.2004.11.075 Tichy, J., & Novak, J. (2000). Detection of antimicrobials in bee products with activity against viridans streptococci. Journal of Alternative and Complementary Medicine, 6(5), 383–389. https://doi.org/10.1089/acm.2000.6.383 Tohamy, A. A., Abdella, E. M., Ahmed, R. R., & Ahmed, Y. K. (2014). Assessment of anti-mutagenic, anti-histopathologic Standard methods for pollen research 107 and antioxidant capacities of Egyptian bee pollen and prop- olis extracts. Cytotechnology, 66(2), 283–297. https://doi.org/ 10.1007/s10616-013-9568-0 Tripathi, S. K. M., Kumar, M., Kedves, M., & Varga, B. (2003). LM, SEM and TEM investigations on partially degraded pol- len grains of Cycas rumphii Miq. from India. Plant Cell Biology and Development, Szeged, 15, 28–42. Uhl, M., Ecker, S., Kassie, F., Lhoste, E., Chakraborty, A., Mohn, G., & Knasm€uller, S. (2003). Effect of chrysin, a fla- vonoid compound, on the mutagenic activity of 2-amino-1- methyl-6-phenylimidazo[4,5- b]pyridine (PhIP) and benzo(a)- pyrene (B(a)P) in bacterial and human hepatoma (HepG2) cells. Archives of Toxicology, 77(8), 477–484. https://doi.org/ 10.1007/s00204-003-0469-4 Ulusoy, E., & Kolayli, S. (2014). Phenolic composition and anti- oxidant properties of anzer bee pollen. Journal of Food Biochemistry, 38(1), 73–82. http://.dx.doi.org/10.1111/jfbc. 12027 https://doi.org/10.1111/jfbc.12027 Valentini, A., Miquel, C., & Taberlet, P. (2010). DNA barcoding for honey biodiversity. Diversity, 2(4), 610–617. https://doi. org/10.3390/d2040610 van Laere, O., Lagasse, A., & de Mets, M. (1969). Use of the scan- ning electron microscope for investigating pollen grains iso- lated from honey samples. Journal of Apicultural Research, 8(3), 139–145. https://doi.org/10.1080/00218839.1969.11100230 van Meeuwen, J. A., Korthagen, N., De Jong, P. C., Piersma, A. H., & van den Berg, M. (2007). (Anti)estrogenic effects of phyto- chemicals on human primary mammary fibroblasts, MCF-7 cells and their co-culture. Toxicology and Applied Pharmacology, 221(3), 372–383. https://doi.org/10.1016/j.taap.2007.03.016 van Rijsbergen, C. (1979). Information retrieval. Butterworths. Villanueva, G. (1999). Pollen resources used by European and Africanized honey bees in the Yucatan peninsula. Mexico. Journal of Apicultural Research, 38(1-2), 105–111. https://doi. org/10.1080/00218839.1999.11101001 Villanueva, M. T. O., Dıaz Marquina, A., Bravo Serrano, R., & Blazquez Abellan, G. (2002). The importance of bee-col- lected pollen in the diet: A study of its composition. International Journal of Food Sciences and Nutrition, 53(3), 217–224. https://doi.org/10.1080/09637480220132832 Vorwohl, G. (1990). Progress, problems and future tasks of Melissopalynologie. Apidologie, 21(5), 383–389. (Article in German). https://doi.org/10.1051/apido:19900501 Wang, L., & Weller, C. L. (2006). Recent advances in extraction of nutraceuticals from plants. Trends in Food Science & Technology, 17(6), 300–312. https://doi.org/10.1016/j.tifs.2005.12.004 Wang, Q., Garrity, G. M., Tiedje, J. M., & Cole, J. R. (2007). Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and Environmental Microbiology, 73(16), 5261–5267. https://doi. org/10.1128/AEM.00062-07 Wang, S., Xie, B., Yin, L., Duan, L., Li, Z., Eneji, A. E., Tsuji, W., & Tsunekawa, A. (2010). Increased UV-B radiation affects the viability, reactive oxygen species accumulation and antioxidant enzyme activities in maize (Zea mays L.) pollen. Photochemistry and Photobiology, 86(1), 110–116. https://doi.org/10.1111/j.1751-1097.2009.00635.x Wang, W., Hu, J., Cheng, J. (1987). Biological effect of pollen from beehives radioprotective effect on hematopoietic tis- sues of irradiated mice. In Proceedings of the 31st International Apicultural Congress Apimondia, p. 176. Wasek, M., Nartowska, J., Wawer, I., & Tudruj, T. (2001). Electron spin resonance assessment of the antioxidative poten- tial of medicinal plants. Part 1. Contribution of anthocyanosides and flavonoids to the radical scavenging ability of fruits and herbal teas. Acta Poloniae Pharmaceutica, 58(4), 283–288. Wiegand, I., Hilpert, K., & Hancock, R. E. W. (2008). Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature Protocols, 3(2), 163–175. https://doi.org/10.1038/nprot.2007.521 Wilkins, T. D., & Thiel, T. (1973). Modified broth-disk method for testing the antibiotic susceptibility of anaerobic bacteria. Antimicrobial Agents and Chemotherapy, 3(3), 350–356. https://doi.org/10.1128/AAC.3.3.350 Williams, N. M., & Kremen, C. (2007). Resource distributions among habitats determine solitary bee offspring production in a mosaic landscape. Ecological Applications, 17(3), 910–921. https://doi.org/10.1890/06-0269 Witten, I. H., & Frank, E. (2005). Data mining: Practical machine learning tools and techniques. (2nd ed.). Morgan Kaufmann. https://doi.org/10.1016/b978-0-12-374856-0.00023-7 Xiong, A., Yang, L., He, Y., Zhang, F., Wang, J., Han, H., Wang, C., Bligh, S. W. A., & Wang, Z. (2009). Identification of metabolites of adonifoline, a hepatotoxic pyrrolizidine alkaloid, by liquid chromatography/tandem and high-resolution mass spectrom- etry. Rapid Communications in Mass Spectrometry, 23(24), 3907–3916. https://doi.org/10.1002/rcm.4329 Yamaguchi, M., Uchiyama, S., & Nakagawa, T. (2007). Preventive effects of bee pollen Cistus iadaniferus extract on bone loss in ovariectomized rats in vivo. Journal of Health Science, 53(5), 571–575. https://doi.org/10.1248/jhs. 52.268[10.1248/jhs.53.571] Ya~nez, Y. A., Remsberg, C. M., Takemoto, J. K., Vega-Villa, K. R., Andrews, P. K., Sayre, C. L., Yang, K., Wu, D., Liu, D., Chen, J., & Sun, P. (2013). Characterization of chemical composition of bee pollen in China. Journal of Agricultural and Food Chemistry, 61(3), 708–718. https://doi.org/10.1021/jf304056b Yang, W. Z., Qiao, X., Bo, T., Wang, Q., Guo, D. A., & Ye, M. (2014). Low energy induced homolytic fragmentation of flavo- nol 3-O-glycosides by negative electrospray ionization tandem mass spectrometry. Rapid Communications in Mass Spectrometry, 28(4), 385–395. https://doi.org/10.1002/rcm.6794 Yerlikaya, O. (2014). Effect of bee pollen supplement on anti- microbial, chemical, rheological, sensorial properties and pro- biotic viability of fermented milk beverages. Mljekarstvo, 64(4), 268–279. https://doi.org/10.15567/mljekarstvo.2014.0406 Youssef, A. M., Farag, R. S., Ewies, M. A., & El-Shakaa, S. M. A. (1978). Chemical studies on pollen collected by honey bees in Giza region, Egypt. Journal of Apicultural Research, 17(3), 110–113. https://doi.org/10.1080/00218839.1978.11099914 Yu, L. (2001). Free radical scavenging properties of conjugated linoleic acids. Journal of Agricultural and Food Chemistry, 49(7), 3452–3456. https://doi.org/10.1021/jf010172v Zhang, X., Habib, F. K., Ross, M., Burger, U., Lewenstein, A., Rose, K., & Jaton, J. (1995). Isolation and characterization of a cyclic hydroxamic acid from a pollen extract, which inhibits cancerous cell growth in vitro. Journal of Medicinal Chemistry, 38(4), 735–738. https://doi.org/10.1021/jm00004a019 Appendix: authors 1. Introduction Maria Grac¸a R Campos, Ofelia Anjos and Norman L Carreck 2. Producing bee pollen from harvest to storage Lidia M R C Barreto, Maria G R Campos and Jo~ao C Nordi 3. Inexpensive pollen load authentication by means of computer vision and machine learning Manuel Chica and Pascual Campoy 4. Evaluation and classification of corbicular pol- len morphology Janka Nozkova 108 M. G. Campos et al. 5. Identification of the floral origin of bee pollen by microscopy Olena Lokutova, Maria G R Campos, Ananias Pascoal, Letıcia M Estevinho 6. Phenolic and polyphenolic profiles as fingerprints of floral origin of bee pollen Maria G R Campos, Norma Almaraz-Abarca, Lıgia Muradian- Bicudo and Ofelia Anjos 7. Determination of phenolic profile of bee pollen extracts by LC and LC/MS Zivoslav Lj Tesic, Mirjana D Mosic, Aleksandar Z Kostic, Mirjana B Pesic, Dusanka M Milojkovic-Opsenica 8. Standard method for identification of bee pollen mixtures through meta-barcoding Wiebke Sickel, Markus J Ankenbrand, Gudrun Grimmer, Frank F€orster, Ingolf Steffan-Dewenter and Alexander Keller 9. Standard method for the determination of protein content of pollen using the Kjeldahl method Chrysoula H Tananaki, Vasilios Liolios, Dimitrios Kanelis, Maria-Anna Rodopoulou and Andreas Thrasyvoulou 10. Standard method for determination of lipid con- tent of pollen using Soxhlet extraction Chrysoula H Tananaki, Vasilios Liolios, Dimitrios Kanelis, Maria-Anna Rodopoulou and Andreas Thrasyvoulou 11. Determination of the content of sugars in pollen, using HPLC-RID Teresa SzczeRsna 12. Standard method for vitamin analysis in bee pollen Ligia Bicudo de Almeida-Muradian 13. Standard methods for mineral and trace elements in bee pollen Ofelia Anjos, Luısa Paulo and Maria Grac¸a Campos 14. Standard methods for pyrrolizidine alkaloid profil- ing in pollen by UHPLC-HRMS Matteo A Lucchetti, Christina Kast and Gaetan Glauser 15. Standard methods for total phenolic compounds, total flavonoids and antioxidative capacity bee pollen evaluation by FTIR-ATR Spectroscopy Ofelia Anjos and Letıcia M Estevinho 16. Standard methods for determination of antioxi- dant bioactivity of bee pollen Norma Almaraz-Abarca, Ligia Bicudo de Almeida-Muradian and Maria G Campos 17. Standard methods for anti-inflammatory activities in bee pollen Ananias Pascoal, Vanessa Branco Paula and Letıcia M Estevinho 18. Standard methods for antimicrobial activities in bee pollen Ananias Pascoal, Vanessa Branco Paula and Letıcia M Estevinho 19. Determination of standard methods for anti-muta- genic activities in bee pollen Ananias Pascoal, Vanessa Branco Paula and Letıcia M Estevinho Standard methods for pollen research 109